Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EHU107721

Sigma-Aldrich

MISSION® esiRNA

targeting human HSF1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

ATTCCCTCCTTGCTCGAGATGGATCTGCCCGTGGGCCCCGGCGCGGCGGGGCCCAGCAACGTCCCGGCCTTCCTGACCAAGCTGTGGACCCTCGTGAGCGACCCGGACACCGACGCGCTCATCTGCTGGAGCCCGAGCGGGAACAGCTTCCACGTGTTCGACCAGGGCCAGTTTGCCAAGGAGGTGCTGCCCAAGTACTTCAAGCACAACAACATGGCCAGCTTCGTGCGGCAGCTCAACATGTATGGCTTCCGGAAAGTGGTCCACATCGAGCAGGGCGGCCTGGTCAAGCCAGAGAGAGACGACACGGAGTTCCAGCACCCATGCTTCCTGCGTGGCCAGGAGCAGCTCCTTGAGAACATCAAGAGGAAAGTGACCAGTGTGTCCACCCTGAAGAGTGAAGACATAAAGATCCGCCAGGA

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Catégories apparentées

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Seok Jun Kim et al.
Yonsei medical journal, 59(9), 1041-1048 (2018-10-18)
Heat shock factor 1 (HSF1) is a key regulator of the heat shock response and plays an important role in various cancers. However, the role of HSF1 in gastric cancer is still unknown. The present study evaluated the function of
Liang Chen et al.
Cell cycle (Georgetown, Tex.), 18(1), 60-68 (2018-12-20)
Cells mainly rely on stress proteins, such as heat-shock proteins (HSPs), to respond to various proteotoxic conditions. These proteins protect tumor cells and enhance their survive. However, the regulation of stress proteins involved in protein quality control (PQC) is still
Antonio Cigliano et al.
Oncotarget, 8(33), 54149-54159 (2017-09-15)
Upregulation of the heat shock transcription factor 1 (HSF1) has been described as a frequent event in many cancer types, but its oncogenic role in hepatocellular carcinoma (HCC) remains poorly delineated. In the present study, we assessed the function(s) of
Ye-Ji Jeong et al.
PloS one, 10(6), e0128552-e0128552 (2015-06-02)
Radiation enteropathy is a common complication in cancer patients. The aim of this study was to investigate whether radiation-induced intestinal injury could be alleviated by coniferyl aldehyde (CA), an HSF1-inducing agent that increases cellular HSP70 expression. We systemically administered CA
Jacqueline H L Fok et al.
Clinical cancer research : an official journal of the American Association for Cancer Research, 24(10), 2395-2407 (2018-02-03)
Purpose: Myeloma is a plasma cell malignancy characterized by the overproduction of immunoglobulin, and is therefore susceptible to therapies targeting protein homeostasis. We hypothesized that heat shock factor 1 (HSF1) was an attractive therapeutic target for myeloma due to its

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique