Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EHU107711

Sigma-Aldrich

MISSION® esiRNA

targeting human SNW1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

ATGATCCAGACCTGCAAAGGCCCGATGAAGAAGCTATTAAAGAGATAACAGAAAAGACAAGAGTAGCCTTAGAAAAATCTGTATCACAGAAGGTCGCCGCAGCCATGCCAGTTCGAGCAGCTGACAAATTGGCTCCTGCTCAGTATATCCGATACACACCATCTCAGCAAGGAGTGGCATTCAACTCTGGAGCTAAACAGAGGGTTATTCGGATGGTAGAAATGCAGAAAGATCCAATGGAGCCTCCAAGGTTCAAGATTAATAAGAAAATTCCCCGGGGACCACCTTCTCCTCCTGCGCCTGTCATGCATTCTCCTAGCCGAAAGATGACTGTAAAGGAACAACAAGAGTGGAAGATTCCTCCTTGTATTTCTAACTGGAAAAATGCAAAGGGTTATACAATTCCATTAGACAAACGTCTGGCTGCTGATGGAAGAGGACTACAGACAGTACACATAAATGAAAATTTCGCCAAATTGGCAGAAGCCCTCTACA

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Qiao Zhang et al.
Microbes and infection, 22(10), 576-584 (2020-08-18)
The Ski-interacting protein (SNW1) acts as a transcriptional co-regulator associated with mRNA splicing and transcription, cell cycle progression, acute and chronic inflammatory responses, however, its role involved in host antiviral innate immune responses remains to be explored. Here, for the
Shusen Zhang et al.
Molecular and cellular biochemistry, 410(1-2), 1-9 (2015-08-12)
SYF2, also known as p29/NTC31/CBPIN, encodes a nuclear protein that interacts with Cyclin D-type binding-protein 1. SYF2 has been reported to be involved in pre-mRNA splicing and cell cycle regulation. In the present study, we observed that SYF2 was obviously
E M Davies et al.
Oncogene, 34(28), 3711-3727 (2014-09-23)
Glioblastoma is the most common and lethal primary malignant brain tumor in adults. The tumor suppressor gene PTEN is deleted, mutated or hypermethylated in more than 60% of glioblastoma cases resulting in hyperactivation of the phosphoinositide 3-kinase pathway, which leads

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique