Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU106761

Sigma-Aldrich

MISSION® esiRNA

targeting human STUB1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CAATCTGCAGCGAGCTTACAGCCTGGCCAAGGAGCAGCGGCTGAACTTCGGGGACGACATCCCCAGCGCTCTTCGAATCGCGAAGAAGAAGCGCTGGAACAGCATTGAGGAGCGGCGCATCCACCAGGAGAGCGAGCTGCACTCCTACCTCTCCAGGCTCATTGCCGCGGAGCGTGAGAGGGAGCTGGAAGAGTGCCAGCGAAACCACGAGGGTGATGAGGACGACAGCCACGTCCGGGCCCAGCAGGCCTGCATTGAGGCCAAGCACGACAAGTACATGGCGGACATGGACGAGCTTTTTTCTCAGGTGGATGAGAAGAGGAAGAAGCGAGACATCCCCGACTACCTGTGTGGCAAGATCAGCTTTGAGCTGATGCGGGAGCCGTGCATCACGCCCAGTGGCATCACCTACGACCGCAAGGACATCGAGGAGCACCTGCAGCGTGTGGGTCATTTTGACCCCGTGACCCGGAGCCCCCTGACCCAGGAACAGCTCATCCCCAACTTG

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Qasim A Khan et al.
PloS one, 13(7), e0199699-e0199699 (2018-07-07)
ALDH1L1 is a folate-metabolizing enzyme abundant in liver and several other tissues. In human cancers and cell lines derived from malignant tumors, the ALDH1L1 gene is commonly silenced through the promoter methylation. It was suggested that ALDH1L1 limits proliferation capacity
Tao Xu et al.
American journal of cancer research, 7(2), 289-300 (2017-03-25)
Glioblastoma (GBM) is the most frequent, aggressive and fatal tumor in the central nervous system, while PTEN signaling is frequently deregulated in human GBM. We previously reported the up-regulation of the carboxyl terminal of Hsp70-interacting protein (CHIP) in GBM, however
Pengfei Zhang et al.
Cell death and differentiation, 27(11), 3177-3195 (2020-06-03)
Ovarian tumour domain-containing protein 3 (OTUD3), a key OTU (ovarian tumour protease) family deubiquitylase, plays context-dependent roles in cancers. It suppresses tumorigenesis in breast, colon, liver and cervical cancer through stabilizing PTEN (phosphatase and tension homologue deleted on chromosome 10)
Hyo Jeong Yong et al.
Oncotarget, 8(41), 69833-69846 (2017-10-21)
Hypoxia-induced interleukin-32β (IL-32β) shifts the metabolic program to the enhanced glycolytic pathway. In the present study, the underlying mechanism by which hypoxia-induced IL-32β stability is regulated was investigated in ovarian cancer cells. IL-32β expression increased under hypoxic conditions in ovarian
Jian Wang et al.
Oncotarget, 7(49), 81377-81388 (2016-11-12)
The androgen receptor (AR) is not only a ligand-dependent transcription factor, but also functions as a licensing factor, a component of DNA replication, which is degraded during mitosis. Furthermore, the deregulation of AR activity is involved in the initiation of

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique