Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EHU105981

Sigma-Aldrich

MISSION® esiRNA

targeting human BMPR1A

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

100

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TGCAAGAGCATCTCAAGCAGACGTCGTTACAATCGTGATTTGGAACAGGATGAAGCATTTATTCCAGTTGGAGAATCACTAAAAGACCTTATTGACCAGTCACAAAGTTCTGGTAGTGGGTCTGGACTACCTTTATTGGTTCAGCGAACTATTGCCAAACAGATTCAGATGGTCCGGCAAGTTGGTAAAGGCCGATATGGAGAAGTATGGATGGGCAAATGGCGTGGCGAAAAAGTGGCGGTGAAAGTATTCTTTACCACTGAAGAAGCCAGCTGGTTTCGAGAAACAGAAATCTACCAAACTGTGCTAATGCGCCATGAAAACATACTTGGTTTCATAGCGGCAGACATTAAAGGTACAGGTTCCTGGACTCAGCTCTATTTGATTACTGATTACCATGAAAATGGATCTCTCTATGACTTCCTGAAATGTGCTACACTGGACACCAGAGCCCTGCTTAAATTGGCTTATTCAGCTGCCTGTGGTCTGTGCCACCTGCACACAGAAATTTATGGCACCCAAGGAAAG

Numéro d'accès Ensembl | humain

ENSG00000107779

Numéro d'accès NCBI

NM_004329

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... BMPR1A(657) , BMPR1A(657)

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Wencai Shi et al.
Biological trace element research, 176(2), 294-304 (2016-09-24)
Hepcidin synthesis is reported to be inadequate according to the body iron store in patients with non-alcoholic fatty liver disease (NAFLD) undergoing hepatic iron overload (HIO). However, the underlying mechanisms remain unclear. We hypothesize that hepatocyte nuclear factor-4α (HNF-4α) may
Zhixian Yu et al.
PloS one, 11(12), e0168334-e0168334 (2016-12-16)
Approximately 30% of tumor endothelial cells have over-duplicated (>2) centrosomes, which may contribute to abnormal vessel function and drug resistance. Elevated levels of vascular endothelial growth factor A induce excess centrosomes in endothelial cells, but how other features of the
Mian Guo et al.
Carcinogenesis, 35(8), 1698-1706 (2014-02-01)
Bone morphogenetic protein-2 (BMP-2), a member of the transforming growth factor-β family, plays critical roles in cell differentiation, modeling and regeneration processes in several tissues. BMP-2 is also closely associated with various malignant tumors. microRNAs negatively and posttranscriptionally regulate gene

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique