Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU104461

Sigma-Aldrich

MISSION® esiRNA

targeting human AZGP1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CTGTCCTGCTGTCTCTGCTGCTGCTTCTGGGTCCTGCTGTCCCCCAGGAGAACCAAGATGGTCGTTACTCTCTGACCTATATCTACACTGGGCTGTCCAAGCATGTTGAAGACGTCCCCGCGTTTCAGGCCCTTGGCTCACTCAATGACCTCCAGTTCTTTAGATACAACAGTAAAGACAGGAAGTCTCAGCCCATGGGACTCTGGAGACAGGTGGAAGGAATGGAGGATTGGAAGCAGGACAGCCAACTTCAGAAGGCCAGGGAGGACATCTTTATGGAGACCCTGAAAGACATCGTGGAGTATTACAACGACAGTAACGGGTCTCACGTATTGCAGGGAAGGTTTGGTTGTGAGATCGAGAATAACAGAAGCAGCGGAGCATTCTGGAAATATTACTATGATGGAAAGGACTACATTGAATTCAACAAAGAAATCCCAGCC

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

P M Sanders et al.
British journal of cancer, 90(6), 1274-1278 (2004-03-18)
Lipid-mobilising factor (LMF) is produced by cachexia-inducing tumours and is involved in the degradation of adipose tissue, with increased oxidation of the released fatty acids through an induction of uncoupling protein (UCP) expression. Since UCP-2 is thought to be involved
Yingming Xue et al.
International journal of molecular sciences, 16(1), 691-703 (2015-01-07)
Zinc-α-2-glycoprotein (AZGP1) is a 41-kDa secreted glycoprotein, which has been detected in several malignancies. The diagnostic value of AZGP1 in serum of prostate and breast cancer patients has been reported. Analyzing "The Cancer Genome Atlas" data, we found that in
Xinhua Xiao et al.
Molecular and cellular endocrinology, 439, 155-164 (2016-06-07)
Zinc alpha2 glycoprotein (ZAG) plays an important role in stimulating fat mobilization and lipolysis in adipose tissue, but its role in hepatic lipid metabolism remains unclear. Palmitic acid (PA) was used to stimulate HepG2 cells with ZAG overexpression or ZAG

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique