Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU094591

Sigma-Aldrich

MISSION® esiRNA

targeting human MYB

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GGGCAGTAGAGCTTGGACAGAAAGAAAAGAAACTTGGTGTTAGGTAATTGACTATGCACTAGTATTTCAGACTTTTTAATTTTATATATATATACATTTTTTTTCCTTCTGCAATACATTTGAAAACTTGTTTGGGAGACTCTGCATTTTTTATTGTGGTTTTTTTGTTATTGTTGGTTTATACAAGCATGCGTTGCACTTCTTTTTTGGGAGATGTGTGTTGTTGATGTTCTATGTTTTGTTTTGAGTGTAGCCTGACTGTTTTATAATTTGGGAGTTCTGCATTTGATCCGCATCCCCTGTGGTTTCTAAGTGTATGGTCTCAGAACTGTTGCATGGATCCTGTGTT

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Xuefeng Li et al.
Nature microbiology, 1(10), 16132-16132 (2016-09-28)
MicroRNAs (miRNAs) play critical roles in various biological processes, including cell proliferation, development and host defence. However, the molecular mechanism for miRNAs in regulating bacterial-induced inflammation remains largely unclear. Here, we report that miR-301b augments pro-inflammatory response during pulmonary infection
Yue Wang et al.
Cancer letters, 385, 234-242 (2016-10-25)
The oncoprotein Yes-associated protein (YAP) in Hippo pathway plays crucial roles in the development of cancer. However, the mechanism of YAP regulation in cancer remains poorly understood. Here, we supposed that the oncoprotein hepatitis B X-interacting protein (HBXIP) might be
Tian Lan et al.
Cancer research, 79(13), 3220-3234 (2019-05-19)
Understanding the roles of noncoding RNAs (ncRNA) in tumorigenesis and metastasis would establish novel avenues to identify diagnostic and therapeutic targets. Here, we aimed to identify hepatocellular carcinoma (HCC)-specific ncRNA and to investigate their roles in hepatocarcinogenesis and metastasis. RNA-seq
Neil Rajan et al.
The Journal of pathology, 239(2), 197-205 (2016-03-13)
Cutaneous cylindroma is an adnexal tumour with apocrine differentiation. A predisposition to multiple cylindromas is seen in patients with Brooke-Spiegler syndrome, who carry germline mutations in the tumour suppressor gene CYLD. Previous studies of inherited cylindromas have highlighted the frequent
Sapana Jalnapurkar et al.
Stem cell research & therapy, 7(1), 171-171 (2016-11-24)
The success of hematopoietic stem cell (HSC) transplantation is dependent on the quality of the donor HSCs. Some sources of HSCs display reduced engraftment efficiency either because of inadequate number (e.g., fetal liver and cord blood), or age-related dysfunction (e.g.

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique