Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU094491

Sigma-Aldrich

MISSION® esiRNA

targeting human NPHS1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TATTCCCGAGGTTTCACAGGTGAAGATGAGGATATGGCCTTCCCTGGGCACTTGTATGATGAGGTAGAAAGAACGTACCCCCCGTCTGGAGCCTGGGGACCCCTCTACGATGAAGTGCAGATGGGACCCTGGGACCTCCACTGGCCTGAAGACACATATCAGGATCCAAGAGGAATCTATGACCAGGTGGCCGGAGACTTGGACACTCTGGAACCCGATTCTCTGCCCTTCGAGCTGAGGGGACATCTGGTGTAAGAGCCCTCTCAACCCCATTGTCCTGCACCTGCAGGAATTTACACTCCACTGGTCTCTCTCATTACAGCCTGGGCCGAGCTGGTTAGGTGAGCTCCATAAAACCCA

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Hossein Tezval et al.
BMC cancer, 13, 199-199 (2013-04-24)
Significance of Urocortin (Ucn or UcnI), Ucn2, Ucn3 and their receptors, Corticotropin Releasing Factor Receptor 1 and 2 (CRFR1 and CRFR2), and the binding protein, Corticotropin-Releasing Hormone-Binding Protein (CRHBP) in oncology is growing rapidly. The objective of our study was
Jiyoun Lee et al.
Scientific reports, 7(1), 12346-12346 (2017-09-29)
Hypertrophy is a prominent feature of damaged podocytes in diabetic kidney disease (DKD). mTORC1 hyperactivation leads to podocyte hypertrophy, but the detailed mechanism of how mTORC1 activation occurs under pathological conditions is not completely known. Moreover, reduced nephrin tyrosine phosphorylation

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique