Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EHU093621

Sigma-Aldrich

MISSION® esiRNA

targeting human IQGAP3

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GAGGCGTCTGCACTACTTCCAGAAGAATGTTAACTCCATTGTGAAGATCCAGGCATTTTTCCGAGCCAGGAAAGCCCAAGATGACTACAGGATATTAGTGCATGCACCCCACCCTCCTCTCAGTGTGGTACGCAGATTTGCCCATCTCTTGAATCAAAGCCAGCAAGACTTCTTGGCTGAGGCAGAGCTGCTGAAGCTCCAGGAAGAGGTAGTTAGGAAGATCCGATCCAATCAGCAGCTGGAGCAGGACCTCAACATCATGGACATCAAGATTGGCCTGCTGGTGAAGAACCGGATCACTCTGCAGGAAGTGGTCTCCCACTGCAAGAAGCTGACCAAGAGGAATAAGGAACAGCTGTCAGATATGATGGTTCTGGACAAGCAGAAGGGTTTAAAGTCGCTGAGCAAAGAGAAACGGCAGAA

Numéro d'accès Ensembl | humain

ENSG00000183856

Numéro d'accès NCBI

NM_178229

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... IQGAP3(128239) , IQGAP3(128239)

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Yongjie Shi et al.
Journal of translational medicine, 15(1), 176-176 (2017-08-16)
Hepatocellular carcinoma (HCC) is one of the most lethal cancers worldwide owing to its high rates of metastasis and recurrence. The oncogene IQ motif-containing GTPase activating protein 3 (IQGAP3) is ubiquitously overexpressed in several human cancers, including liver, ovary, lung
Naohide Oue et al.
Pathobiology : journal of immunopathology, molecular and cellular biology, 85(3), 192-200 (2017-11-14)
Spheroid colony formation is a useful method of cancer stem cell (CSC) characterization. We previously showed that the IQ motif containing the GTPase-activating protein 3 gene (IQGAP3) is upregulated in spheroid body-forming gastric cancer (GC) cells compared with parental cells.
Chase J Morgan et al.
Scientific reports, 9(1), 11057-11057 (2019-08-01)
The Ras family of small GTPases modulates numerous essential processes. Activating Ras mutations result in hyper-activation of selected signaling cascades, which leads to human diseases. The high frequency of Ras mutations in human malignant neoplasms has led to Ras being

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique