Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU092951

Sigma-Aldrich

MISSION® esiRNA

targeting human CREB1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GGAGTGCCAAGGATTGAAGAAGAGAAGTCTGAAGAGGAGACTTCAGCACCTGCCATCACCACTGTAACGGTGCCAACTCCAATTTACCAAACTAGCAGTGGACAGTATATTGCCATTACCCAGGGAGGAGCAATACAGCTGGCTAACAATGGTACCGATGGGGTACAGGGCCTGCAAACATTAACCATGACCAATGCAGCAGCCACTCAGCCGGGTACTACCATTCTACAGTATGCACAGACCACTGATGGACAGCAGATCTTAGTGCCCAGCAACCAAGTTGTTGTTCAAGCTGCCTCTGGAGACGTACAAACATACCAGATTCGCACAGCACCCACTAGCACTATTGCCCCTGGAGTTGTTATGGCATCCTCCCCAGCACTTCCTACACAGCCTGCTGAAGAAGCAGCACGAAAGAGAGAGG

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

L Yuan et al.
Neuropathology and applied neurobiology, 42(7), 607-620 (2015-11-04)
14,15-Epoxyeicosatrienoic acid (14,15-EET) is abundantly expressed in brain and exerts protective effects against ischaemia. 14,15-EET is hydrolysed by soluble epoxide hydrolase (sEH). sEH-/- mice show a higher level of 14,15-EET in the brain. Astrocytes play a pivotal role in neuronal
Carole Y Perrot et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, fj201700818RRR-fj201700818RRR (2018-05-19)
The increase in cAMP levels in endothelial cells triggers cellular signaling to alter vascular permeability. It is generally considered that cAMP signaling stabilizes the endothelial barrier function and reduces permeability. However, previous studies have only examined the permeability shortly after
Wenjing Xu et al.
EBioMedicine, 43, 32-42 (2019-04-20)
Angiogenesis improves reperfusion to the ischaemic tissue after vascular obstruction. The underlying molecular mechanisms of post-ischaemic angiogenesis are not clear. FAM3A belongs to the family with sequence similarity 3 (FAM3) genes, but its biological function in endothelial cells in regards
Hui-Xia Geng et al.
Neurochemical research, 42(10), 2841-2849 (2017-05-17)
Neuronal apoptosis mediated by the mitochondrial apoptosis pathway is an important pathological process in cerebral ischemia-reperfusion injury. 14,15-EET, an intermediate metabolite of arachidonic acid, can promote cell survival during ischemia/reperfusion. However, whether the mitochondrial apoptotic pathway is involved this survival
Supriya Srinivasan et al.
Cancer research, 78(21), 6146-6158 (2018-09-21)
Although smoking is a significant risk factor for pancreatic ductal adenocarcinoma (PDAC), the molecular mechanisms underlying PDAC development and progression in smokers are still unclear. Here, we show the role of cyclic AMP response element-binding protein (CREB) in the pathogenesis

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique