Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EHU087231

Sigma-Aldrich

MISSION® esiRNA

targeting human BACE1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

100

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

ACATTGCTGCCATCACTGAATCAGACAAGTTCTTCATCAACGGCTCCAACTGGGAAGGCATCCTGGGGCTGGCCTATGCTGAGATTGCCAGGCCTGACGACTCCCTGGAGCCTTTCTTTGACTCTCTGGTAAAGCAGACCCACGTTCCCAACCTCTTCTCCCTGCAGCTTTGTGGTGCTGGCTTCCCCCTCAACCAGTCTGAAGTGCTGGCCTCTGTCGGAGGGAGCATGATCATTGGAGGTATCGACCACTCGCTGTACACAGGCAGTCTCTGGTATACACCCATCCGGCGGGAGTGGTATTATGAGGTGATCATTGTGCGGGTGGAGATCAATGGACAGGATCTGAAAATGGACTGCAAGGAGTACAACTATGACAAGAGCATTGTGGACAGTGGCACCACCAACCTTCGTTTGCCCAAGAAAGTGTT

Numéro d'accès Ensembl | humain

ENSG00000186318

Numéro d'accès NCBI

NM_012104

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... BACE1(23621) , BACE1(23621)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Chi Zhang et al.
Current pharmaceutical biotechnology, 20(1), 56-62 (2019-02-08)
To deliver drugs to treat Alzheimer's Disease (AD), nanoparticles should firstly penetrate through blood brain barrier, and then target neurons. Recently, we developed an Apo A-I and NL4 dual modified nanoparticle (ANNP) to deliver beta-amyloid converting enzyme 1 (BACE1) siRNA.
Nan Zhang et al.
Neuroreport, 31(3), 205-212 (2019-12-27)
Alzheimer's disease is the most common neurodegenerative disease, characterized by accumulation of amyloid β peptides. MicroRNAs have been identified as significant regulators and therapeutic targets of Alzheimer's disease. However, the roles of miR-16-5p and miR-19b-3p and their mechanisms in Alzheimer's
Xiaoyao Zheng et al.
Acta biomaterialia, 49, 388-401 (2016-11-16)
To realize the therapeutic potential of gene drugs for Alzheimer's disease (AD), non-invasive, tissue-specific and efficient delivery technologies must be developed. Here, a hybrid system for amyloid plaques targeted siRNA delivery was formed by PEGylated Poly(2-(N,N-dimethylamino) ethyl methacrylate) (PEG-PDMAEMA) conjugated
Pengzhen Wang et al.
Journal of controlled release : official journal of the Controlled Release Society, 279, 220-233 (2018-04-22)
β-site amyloid precursor protein cleaving enzyme 1 (BACE1) is a key enzyme to cleave the amyloid precursor protein to develop Alzheimer's disease (AD). Reducing BACE1 expression in central neuron through RNA interference technology shows great promise to overcome AD. However
Sujoy Bera et al.
EMBO reports, 21(6), e47954-e47954 (2020-04-24)
Cleavage of amyloid precursor protein (APP) by BACE-1 (β-site APP cleaving enzyme 1) is the rate-limiting step in amyloid-β (Aβ) production and a neuropathological hallmark of Alzheimer's disease (AD). Despite decades of research, mechanisms of amyloidogenic APP processing remain highly

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique