Accéder au contenu
Merck
Toutes les photos(1)

Documents

EHU086071

Sigma-Aldrich

MISSION® esiRNA

targeting human FAP

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GTGGTCCCTGCAGTCAGAGTGTAAGGTCTGTATTTGCTGTTAATTGGATATCTTATCTTGCAAGTAAGGAAGGGATGGTCATTGCCTTGGTGGATGGTCGAGGAACAGCTTTCCAAGGTGACAAACTCCTCTATGCAGTGTATCGAAAGCTGGGTGTTTATGAAGTTGAAGACCAGATTACAGCTGTCAGAAAATTCATAGAAATGGGTTTCATTGATGAAAAAAGAATAGCCATATGGGGCTGGTCCTATGGAGGATACGTTTCATCACTGGCCCTTGCATCTGGAACTGGTCTTTTCAAATGTGGTATAGCAGTGGCTCCAGTCTCCAGCTGGGAATATTACGCGTCTGTCTACACAGAGAGATTCATGGGTCTCCCAACAAAGGATGATAATCTTGAGCACTATAAGAATTCAACTGTGATGGCAAGAGC

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Yuli Lin et al.
Neoplasia (New York, N.Y.), 21(12), 1133-1142 (2019-11-24)
Desmoplasia is a hallmark of intrahepatic cholangiocarcinoma (ICC), which constitutes a barrier to infiltration of lymphocyte, but not myeloid cells. Given that dense desmoplastic stroma has been reported to be a barrier to infiltration of lymphocyte, but not myeloid cells.
Dimitrios Patsouras et al.
Molecular medicine reports, 11(6), 4585-4590 (2015-01-28)
Fibroblast activation protein (FAP), a selective protein for tumor stromal fibroblasts, is expressed in >90% of human epithelial carcinomas. A characteristic feature of pancreatic cancer is an extensive fibrotic or desmoplastic reaction surrounding the primary tumor. The present study aimed
Jochen Tillmanns et al.
Journal of molecular and cellular cardiology, 87, 194-203 (2015-09-01)
Fibroblast activation protein α (FAP) is a membrane-bound serine protease expressed by activated fibroblasts during wound healing in the skin. Expression of FAP after myocardial infarction (MI) and potential effects on cardiac wound healing are largely unknown. MI was induced

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique