Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU084671

Sigma-Aldrich

MISSION® esiRNA

targeting human COPS5

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GGCACTGAAACCCGAGTAAATGCTCAGGCTGCTGCATATGAATACATGGCTGCATACATAGAAAATGCAAAACAGGTTGGCCGCCTTGAAAATGCAATCGGGTGGTATCATAGCCACCCTGGCTATGGCTGCTGGCTTTCTGGGATTGATGTTAGTACTCAGATGCTCAATCAGCAGTTCCAGGAACCATTTGTAGCAGTGGTGATTGATCCAACAAGAACAATATCCGCAGGGAAAGTGAATCTTGGCGCCTTTAGGACATACCCAAAGGGCTACAAACCTCCTGATGAAGGACCTTCTGAGTACCAGACTATTCCACTTAATAAAATAGAAGATTTTGGTGTACACTGCAAACAATATTATGCCTTAGAAGTCTCATATTTCAAATCCTCTTTGGATCGC

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Vous ne trouvez pas le bon produit ?  

Essayez notre Outil de sélection de produits.

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

S Wang et al.
Oncogene, 35(47), 6096-6108 (2016-05-10)
Radiotherapy is the standard therapy for nasopharyngeal carcinoma (NPC); however, radioresistance can hinder successful treatment. Here we report that microRNA (miR)-24 acts as a tumor suppressor and radiosensitizer in NPC cells and xenografts by targeting Jab1/CSN5. Although accumulating evidence has
Yang Liu et al.
Acta pharmaceutica Sinica. B, 10(12), 2299-2312 (2020-12-24)
Programmed cell death-1 (PD-1)/programmed cell death ligand-1 (PD-L1) blocking therapy has become a major pillar of cancer immunotherapy. Compared with antibodies targeting, small-molecule checkpoint inhibitors which have favorable pharmacokinetics are urgently needed. Here we identified berberine (BBR), a proven anti-inflammation
Anja Schwarz et al.
Journal of biomedical science, 24(1), 12-12 (2017-02-09)
Oxidized low-density lipoprotein (oxLDL) mediates the transformation of macrophages (MΦ) to cholesterol-rich foam cells and the release of pro-inflammatory cytokines during atherogenesis. JAB1 (Jun activation domain binding protein-1) is present in all stages of human plaques, involved in the Toll-like
Sandra Jumpertz et al.
Cellular signalling, 34, 38-46 (2017-02-24)
The COP9 signalosome (CSN) is a multi-protein complex that is highly conserved in eukaryotes. Due to its regulatory impact on processes such as cell cycle, DNA damage response and apoptosis, the CSN is essential for mammalian cells. One of the
Michal Meir et al.
Nucleic acids research, 43(9), 4517-4530 (2015-04-10)
The DNA damage response is vigorously activated by DNA double-strand breaks (DSBs). The chief mobilizer of the DSB response is the ATM protein kinase. We discovered that the COP9 signalosome (CSN) is a crucial player in the DSB response and

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique