Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU084051

Sigma-Aldrich

MISSION® esiRNA

targeting human GRB10

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CACAGGACACAGCACTGGTTTCACGGGAGGATCTCCAGGGAGGAATCCCACAGGATCATTAAACAGCAAGGGCTCGTGGATGGGCTTTTTCTCCTCCGTGACAGCCAGAGTAATCCAAAGGCATTTGTACTCACACTGTGTCATCACCAGAAAATTAAAAATTTCCAGATCTTACCTTGCGAGGACGACGGGCAGACGTTCTTCAGCCTAGATGACGGGAACACCAAATTCTCTGACCTGATCCAGCTGGTTGACTTTTACCAGCTGAACAAAGGAGTCCTGCCTTGCAAACTCAAGCACCACTGCATCCGAGTGGCCTTATGACCGCAGATGTCCTCTCGGCTGAAGACTGGAGGAAGTGAACACTGGAGTGAAGAAGCGGTCTGTGCGTTGGTGAAGAAC

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Hui Luo et al.
Frontiers in genetics, 11, 581593-581593 (2020-12-18)
Sertoli cells are central and essential coordinators of spermatogenesis. Accumulating evidence has demonstrated that miRNAs participate in the regulation of Sertoli cell growth. However, the functions and the regulatory mechanisms of miRNAs in Sertoli cells of domestic animals remain largely
Mohammad Imran Khan et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 33(3), 3198-3211 (2018-11-01)
Growth factor receptor-binding protein 10 (GRB10) is a well-known adaptor protein and a recently identified substrate of the mammalian target of rapamycin (mTOR). Depletion of GRB10 increases insulin sensitivity and overexpression suppresses PI3K/Akt signaling. Because the major reason for the

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique