Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EHU083751

Sigma-Aldrich

MISSION® esiRNA

targeting human VCAM1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

100

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

AGTTGAAGGATGCGGGAGTATATGAATGTGAATCTAAAAACAAAGTTGGCTCACAATTAAGAAGTTTAACACTTGATGTTCAAGGAAGAGAAAACAACAAAGACTATTTTTCTCCTGAGCTTCTCGTGCTCTATTTTGCATCCTCCTTAATAATACCTGCCATTGGAATGATAATTTACTTTGCAAGAAAAGCCAACATGAAGGGGTCATATAGTCTTGTAGAAGCACAGAAGTCAAAAGTGTAGCTAATGCTTGATATGTTCAACTGGAGACACTATTTATCTGTGCAAATCCTTGATACTGCTCATCATTCCTTGAGAAAAACAATGAGCTGAGAGGCAGACTTCCCTGAATGTATTGAACTTGGAAAGAAATGCCCATCTATGTCCCTTGCTGTGAGCA

Numéro d'accès Ensembl | humain

ENSG00000162692

Numéro d'accès NCBI

NM_080682

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... VCAM1(7412) , VCAM1(7412)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Orawin Prangsaengtong et al.
Vascular medicine (London, England), 23(3), 201-211 (2018-04-10)
Lymphangiogenesis is the process of new vessel formation from pre-existing lymphatic vessels. The process mainly involves cell adhesion, migration, and tubule formation of lymphatic endothelial cells. Tumor-induced lymphangiogenesis is an important factor contributing to promotion of tumor growth and cancer
Hai-Jian Sun et al.
Scientific reports, 6, 23596-23596 (2016-03-24)
Vascular smooth muscle cells (VSMCs) are indispensible components in foam cell formation. Salusin-β is a stimulator in the progression of atherosclerosis. Here, we showed that salusin-β increased foam cell formation evidenced by accumulation of lipid droplets and intracellular cholesterol content
Ryota Takahashi et al.
Scientific reports, 10(1), 21194-21194 (2020-12-05)
Pancreatic cancer is one of the malignant diseases with the worst prognosis. Resistance to chemotherapy is a major difficulty in treating the disease. We analyzed plasma samples from a genetically engineered mouse model of pancreatic cancer and found soluble vascular
Huilin Ye et al.
Cell death & disease, 9(5), 453-453 (2018-04-20)
Tumor-associated macrophages (TAMs) are frequently found near pancreatic cancer cells, but it is uncertain whether they are involved in pancreatic cancer progression and the Warburg effect. Here, we show that CCL18 secreted by TAMs facilitates malignant progression and induced a
Taek-Keun Kim et al.
Experimental & molecular medicine, 49(2), e294-e294 (2017-02-18)
Tumor necrosis factor alpha (TNFα)-induced angiogenesis plays important roles in the progression of various diseases, including cancer, wet age-related macular degeneration, and rheumatoid arthritis. However, the relevance and role of vascular cell adhesion molecule-1 (VCAM-1) in angiogenesis have not yet
Afficher tous les articles scientifiques apparentés

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique