Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EHU083111

Sigma-Aldrich

MISSION® esiRNA

targeting human CD86

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

AATGGCTCATGACCTGGAAATAAAATTTAGGACCAATACCTCCTCCAGATCAGATTCTTCTCTTAATTTCATAGATTGTGTTTTTTTTTTAAATAGACCTCTCAATTTCTGGAAAACTGCCTTTTATCTGCCCAGAATTCTAAGCTGGTGCCCCACTGAATTTTGTGTGTACCTGTGACTAAACAACTACCTCCTCAGTCTGGGTGGGACTTATGTATTTATGACCTTATAGTGTTAATATCTTGAAACATAGAGATCTATGTACTGTAATAGTGTGATTACTATGCTCTAGAGAAAAGTCTACCCCTGCTAAGGAGTTCTCATCCCTCTGTCAGGGTCAGTAAGGAAAACGGTGGCCTAGGGTACAGGCAACAATGAGCAGACCAACCTAAATTTGGGGAA

Numéro d'accès Ensembl | humain

ENSG00000114013

Numéro d'accès NCBI

NM_175862

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... CD86(942) , CD86(942)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Impacts of CD40- and CD86-Silenced Antigen-Specific B Cells on the Control of Allergies.
Motohiko Suzuki et al.
American journal of rhinology & allergy, 33(5), 513-523 (2019-05-09)
Emi Furusawa et al.
The Journal of investigative dermatology, 139(10), 2164-2173 (2019-04-13)
PD-L2 is a ligand for the immune checkpoint receptor PD-1; however, its regulatory function is unclear. We previously reported that silencing of CD86 in cutaneous dendritic cells by topical application of small interfering RNA (siRNA) inhibits the elicitation of contact
Naila Mebarek et al.
European journal of pharmaceutics and biopharmaceutics : official journal of Arbeitsgemeinschaft fur Pharmazeutische Verfahrenstechnik e.V, 92, 216-227 (2015-03-23)
Dendritic cells (DCs) are professional antigen-presenting cells that play a critical role in maintaining the balance between immunity and tolerance and, as such are a promising immunotherapy tool to induce immunity or to restore tolerance. The main challenge to harness

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique