Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EHU079951

Sigma-Aldrich

MISSION® esiRNA

targeting human PLAGL1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TGGAAAACGAGACTGGGACTATGGCTTATTCAGTGATGACTGGCTTGAGATGATAAGAGAATTCTCGAACTGCATGTATTGTGCCAATCTGTCCTGAGTGTTCATGCTTTGTACCAAATTTAATGAACGCGTGTTCTGTAATCAAACTGCAAATATTGTCATAACCAACATCCAAAATGACGGCTGCTATATATAAGTGTTTGTCATATGGAATTTAATCGTAAGCCATGATCATAATGTTAACTAAATAACTTTATGTGGCACTGCCTAGTAAGGGAACTATGGAAAGGTTTGGATTTCTCCAAATCTGGGAGAATTTTCAAAATAAGAAAATAACCTTTATATGATATACTATGACTAGGCTGTGTATTTCTTTTCAGGGATTTTTCTACCTTCAGGGTTGGA

Numéro d'accès Ensembl | humain

ENSG00000118495

Numéro d'accès NCBI

NM_002656

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... PLAGL1(5325) , PLAGL1(5325)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Rebekah R Starks et al.
International journal of molecular sciences, 21(21) (2020-11-12)
During pregnancy, the placenta is important for transporting nutrients and waste between the maternal and fetal blood supply, secreting hormones, and serving as a protective barrier. To better understand placental development, we must understand how placental gene expression is regulated.
Yeyou Liang et al.
Metabolism: clinical and experimental, 64(12), 1682-1693 (2015-10-13)
Evidence shows that both macrophage migration inhibitory factor (MIF) and GLUT4 glucose transporter are involved in diabetic cardiomyopathy (DCM), but it remains largely unknown whether and how MIF regulates GLUT4 expression in cardiomyocytes. The present study aims to investigate the

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique