Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EHU075981

Sigma-Aldrich

MISSION® esiRNA

targeting human NECTIN2

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

100

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GAGGACGAGGGCAACTACACTTGCGAGTTTGCCACCTTCCCCAAGGGGTCCGTCCGAGGGATGACCTGGCTCAGAGTCATAGCCAAGCCCAAGAACCAAGCTGAGGCCCAGAAGGTCACGTTCAGCCAGGACCCTACGACAGTGGCCCTCTGCATCTCCAAAGAGGGCCGCCCACCTGCCCGGATCTCCTGGCTCTCATCCCTGGACTGGGAAGCCAAAGAGACTCAGGTGTCAGGGACCCTGGCCGGAACTGTCACTGTCACCAGCCGCTTCACCTTGGTGCCCTCGGGCCGAGCAGATGGTGTCACGGTCACCTGCAAAGTGGAGCATGAGAGCTTCGAGGAACCAGCCCTGATACCTGTGACCCTCTCTGTACGCTACCCTCCTGAAGTGTCCATCTCCGGCTA

Numéro d'accès Ensembl | humain

ENSG00000130202

Numéro d'accès NCBI

NM_002856

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... NECTIN2(5819) , PVRL2(5819)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Fabian Wolpert et al.
PloS one, 10(10), e0139603-e0139603 (2015-10-07)
Immunotherapy targeting glioblastoma initiating cells (GIC) is considered a promising strategy. However, GIC are prone to evade immune response and there is a need for potent adjuvants. IFN-β might enhance the immune response and here we define its net effect
Benjamin Murter et al.
Cancer immunology research, 7(2), 244-256 (2019-01-20)
A limitation to antitumor immunity is the dysfunction of T cells in the tumor microenvironment, in part due to upregulation of coinhibitory receptors such as PD-1. Here, we describe that poliovirus receptor-related immunoglobulin domain protein (PVRIG) acts as a coinhibitory
Elisabeth Devilard et al.
PloS one, 8(10), e77424-e77424 (2013-10-12)
Lymphocyte trafficking and migration through vascular endothelial cells (ECs) in secondary lymphoid tissues is critical for immune protection. In the present study, we investigate the role of nectin cell adhesion molecules for the migration of lymphocytes through ECs. Nectins are
Pei-Suen Tsou et al.
Arthritis & rheumatology (Hoboken, N.J.), 68(12), 2975-2985 (2016-08-03)
Vascular dysfunction represents a disease-initiating event in systemic sclerosis (SSc; scleroderma). Results of recent studies suggest that epigenetic dysregulation impairs normal angiogenesis and can result in abnormal patterns of blood vessel growth. Histone deacetylases (HDACs) control endothelial cell (EC) proliferation

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique