Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU074691

Sigma-Aldrich

MISSION® esiRNA

targeting human GABPA

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

100

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GCAGAGTGCACAGAAGAAAGCATTGTAGAACAAACCTACGCGCCAGCTGAATGTGTAAGCCAGGCCATAGACATCAATGAACCAATAGGCAATTTAAAGAAACTGCTAGAACCAAGACTACAGTGTTCTTTGGATGCTCATGAAATTTGTCTGCAAGATATCCAGCTGGATCCAGAACGAAGTTTATTTGACCAAGGAGTAAAAACAGATGGAACTGTACAGCTTAGTGTACAGGTAATTTCTTACCAAGGAATTGAACCAAAGTTAAACATCCTTGAAATTGTTAAACCTGCGGACACTGTTGAGGTTGTTATTGATCCAGATGCCCACCATGCTGAATCAGAAGCACATCTTGTTGAAGAAGCTCAAGTGATAACTCTTGATGGCACAAAACACATCACAACCATTTCAGATGAAACTTCAGAACAAGTGACAAGATGGGCTGCT

Numéro d'accès Ensembl | humain

ENSG00000154727

Numéro d'accès NCBI

NM_002040

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... GABPA(2551) , GABPA(2551)

Catégories apparentées

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Lingjie Bao et al.
Molecular carcinogenesis, 56(6), 1543-1553 (2017-01-24)
Previously, we have demonstrated that NRF2 plays a key role in mediating cisplatin resistance in ovarian cancer. To further explore the mechanism underlying NRF2-dependent cisplatin resistance, we stably overexpressed or knocked down NRF2 in parental and cisplatin-resistant human ovarian cancer
Yasutaka Mitamura et al.
Oxidative medicine and cellular longevity, 2018, 2475047-2475047 (2018-09-07)
Systemic fibrosing or sclerotic disorders are life-threatening, but only very limited treatment modalities are available for them. In recent years, periostin (POSTN), a major extracellular matrix component, was established by several studies as a novel key player in the progression
Yun Peng Shao et al.
Neurourology and urodynamics, 37(8), 2470-2479 (2018-06-20)
The present work evaluated preventive effect of curcumin on cisplatin-induced bladder cystopathy. Fifteen female rats were divided into (i) Control group administered with physiological saline solution for 5 days; (ii) Cis-P group injected with cisplatin (6 mg/kg); and (iii) Cis-Cur group
Kanako Ono et al.
Placenta, 75, 34-41 (2019-02-05)
Polyunsaturated fatty acids (PUFAs), including arachidonic acid (AA), eicosapentaenoic acid (EPA), and docosahexaenoic acid (DHA), are essential for adequate fetal growth. The aim of the present study was to elucidate the effects of PUFAs on the expression and function of
Limin Xu et al.
Frontiers in cell and developmental biology, 8, 569977-569977 (2020-10-31)
Cerebral ischemic injury is a complicated pathological process. Adipose-derived stromal cells (ADSCs) have been used as a therapeutic strategy, with their therapeutic effects chiefly attributed to paracrine action rather than trans-differentiation. Studies have shown that circAkap7 was found to be
Afficher tous les articles scientifiques apparentés

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique