Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU073541

Sigma-Aldrich

MISSION® esiRNA

targeting human MGEA5

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

AACTGCACCTTGTGAATGGTAGTTGAGGTCTTCATACAGTTCAGCCTCTAGAATGGTAACAAATCAGCCAATTGGATTCGAAACAAAGAAGACTATGTAAAACTCACCCATCACACTTTGAGACTACTCACTGGTTGGAAGAATATAGTATTGCAGCAAATCCTGTATGAAAGAGAGATGTGGGCTTCCTTTTTGAGTCTTGTGTTAGGTGCTGAGACCTTTTACATGGGCTTATACAGGGAGAGAGTCTTCAATAAATGTAGTCAGCACTATTTTCTGCATCCAGTGTGGTTGCGTTTCTCACCTGAGAGTAATCAAGATAACATCTGTCATCTTCCTTGGTTTATTGAGTGAAATGCCTCTCAGTCTTAGGGGACATGGCAGAGATGAAAGAAAGAAAGAGTGGGTTTCAGAAGTGTCAGGGTGGAGTGATTCCAAGTGGGATGGTT

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Vous ne trouvez pas le bon produit ?  

Essayez notre Outil de sélection de produits.

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Miguel C Lucena et al.
The Journal of biological chemistry, 291(25), 12917-12929 (2016-04-30)
Deregulated cellular metabolism is a hallmark of tumors. Cancer cells increase glucose and glutamine flux to provide energy needs and macromolecular synthesis demands. Several studies have been focused on the importance of glycolysis and pentose phosphate pathway. However, a neglected
Md Ataur Rahman et al.
Oxidative medicine and cellular longevity, 2019, 6279313-6279313 (2019-12-13)
The addition of O-linked β-N-acetylglucosamine (O-GlcNAcylation) to serine and threonine residues is a common posttranslational modification of intracellular proteins which modulates protein functions and neurodegenerative diseases, controlled by a single pair of enzymes, O-GlcNAcase (OGA), and O-GlcNAcylation transferase (OGT). Autophagy
Maïté Leturcq et al.
Cellular and molecular life sciences : CMLS, 75(23), 4321-4339 (2018-08-03)
O-GlcNAcylation of proteins is governed by O-GlcNAc transferase (OGT) and O-GlcNAcase (OGA). The homeostasis of O-GlcNAc cycling is regulated during cell cycle progression and is essential for proper cellular division. We previously reported the O-GlcNAcylation of the minichromosome maintenance proteins
Anupriya Chatterjee et al.
Cells, 9(10) (2020-10-23)
Our previous studies identified that retinal endothelial damage caused by hyperglycemia or nucleoside diphosphate kinase-B (NDPK-B) deficiency is linked to elevation of angiopoietin-2 (Ang-2) and the activation of the hexosamine biosynthesis pathway (HBP). Herein, we investigated how NDPK-B is involved

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique