Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EHU072211

Sigma-Aldrich

MISSION® esiRNA

targeting human DKK3

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GCCACCCTCAATGAGATGTTCCGCGAGGTTGAGGAACTGATGGAGGACACGCAGCACAAATTGCGCAGCGCGGTGGAAGAGATGGAGGCAGAAGAAGCTGCTGCTAAAGCATCATCAGAAGTGAACCTGGCAAACTTACCTCCCAGCTATCACAATGAGACCAACACAGACACGAAGGTTGGAAATAATACCATCCATGTGCACCGAGAAATTCACAAGATAACCAACAACCAGACTGGACAAATGGTCTTTTCAGAGACAGTTATCACATCTGTGGGAGACGAAGAAGGCAGAAGGAGCCACGAGTGCATCATCGACGAGGACTGTGGGCCCAGCATGTACTGCCAGTTTGCCAGCTTCCAGTACACCTGCCAGCCATGCCGGGGCCAGAGGATGCTCTGCACCCGGGACAGTGAGTGCTGTGGAGACCAGCTGTGTGTCTGGGGTCACTG

Numéro d'accès Ensembl | humain

ENSG00000050165

Numéro d'accès NCBI

NM_013253

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... DKK3(27122) , DKK3(27122)

Catégories apparentées

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Bo Liu et al.
Experimental and therapeutic medicine, 18(6), 4747-4757 (2019-11-28)
MicroRNA-1303 (miR-1303) is involved in the tumorigenesis and progression of several cancers, and yet the role of miR-1303 in prostate cancer (PCa) and its underlying mechanism are unknown. To explore this issue, the present study aimed to use PCa tissues
Gang Peng et al.
Experimental and therapeutic medicine, 18(1), 769-778 (2019-07-02)
MicroRNAs (miRs) serve important roles in glioma. However, the underlying molecular mechanism of miR-25 in glioma progression remains largely unknown; therefore, it was investigated in the present study. RT-qPCR analysis revealed that miR-25 expression levels were markedly increased in human
Zainab Al Shareef et al.
Oncogene, 37(39), 5305-5324 (2018-06-03)
Aberrant transforming growth factor-β (TGF-β) signaling is a hallmark of the stromal microenvironment in cancer. Dickkopf-3 (Dkk-3), shown to inhibit TGF-β signaling, is downregulated in prostate cancer and upregulated in the stroma in benign prostatic hyperplasia, but the function of

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique