Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU070231

Sigma-Aldrich

MISSION® esiRNA

targeting human SLC7A11

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

ATCTTTGTTGCCCTCTCCTGCTTTGGCTCCATGAACGGTGGTGTGTTTGCTGTCTCCAGGTTATTCTATGTTGCGTCTCGAGAGGGTCACCTTCCAGAAATCCTCTCCATGATTCATGTCCGCAAGCACACTCCTCTACCAGCTGTTATTGTTTTGCACCCTTTGACAATGATAATGCTCTTCTCTGGAGACCTCGACAGTCTTTTGAATTTCCTCAGTTTTGCCAGGTGGCTTTTTATTGGGCTGGCAGTTGCTGGGCTGATTTATCTTCGATACAAATGCCCAGATATGCATCGTCCTTTCAAGGTGCCACTGTTCATCCCAGCTTTGTTTTCCTTCACATGCCTCTTCATGGTTGCCCTTTCCCTCTATTCGGACCCATTTAGTACAGGGATTGGCTTCGTCATCACT

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Naisu Yang et al.
Journal of genetics, 97(2), 463-468 (2018-06-23)
Solute carrier family 7 member 11 (SLC7A11) is a cystine/glutamate exchanger, also known as xCT, has been found to play an important role in pheomelanin synthesis. Adjusting the cystine content of cells to influence pheomelanin synthesis affects the proportion of
Masaki Nagane et al.
PloS one, 13(4), e0195151-e0195151 (2018-04-13)
The sodium-independent cystine-glutamate antiporter plays an important role in extracellular cystine uptake. It comprises the transmembrane protein, xCT and its chaperone, CD98. Because glutathione is only weakly cell membrane permeable, cellular uptake of its precursor, cystine, is known to be
Chun Ge et al.
Scientific reports, 7(1), 3791-3791 (2017-06-21)
Adriamycin (ADR) induces the over-expression of P-glycoprotein (P-gp) and multiple drug resistance in breast cancer cells. However, the biochemical process and underlying mechanisms are not clear. Our previous study revealed that ADR increased reactive oxygen species (ROS) generation and decreased
Yu Li et al.
Oncology letters, 19(1), 323-333 (2020-01-04)
Non-small cell lung cancer (NSCLC) has long been one of the most lethal types of cancer due to its lack of typical clinical symptoms at early stages and high risk of tumour recurrence, even following complete surgical resection. Multicourse chemotherapy
Chaoli Huang et al.
Oncology reports, 40(4), 2363-2370 (2018-08-02)
The tumour‑suppressor protein p53 is a key regulator of multiple cellular processes and exerts its tumour‑suppressor function by inducing apoptotic cell death. However, emerging evidence indicates that p53 is also involved in inducing ferroptosis, which is a unique iron‑dependent form

Global Trade Item Number

RéférenceGTIN
EHU070231-20UG4061828609949
EHU070231-50UG4061828386833

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique