Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EHU070021

Sigma-Aldrich

MISSION® esiRNA

targeting human TFAP2A

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CTGTCCAAGTCCAACAGCAATGCCGTCTCCGCCATCCCTATTAACAAGGACAACCTCTTCGGCGGCGTGGTGAACCCCAACGAAGTCTTCTGTTCAGTTCCGGGTCGCCTCTCGCTCCTCAGCTCCACCTCGAAGTACAAGGTCACGGTGGCGGAAGTGCAGCGGCGGCTCTCACCACCCGAGTGTCTCAACGCGTCGCTGCTGGGCGGAGTGCTCCGGAGGGCGAAGTCTAAAAATGGAGGAAGATCTTTAAGAGAAAAACTGGACAAAATAGGATTAAATCTGCCTGCAGGGAGACGTAAAGCTGCCAACGTTACCCTGCTCACATCACTAGTAGAGGGAGAAGCTGTCCACCTAGCCAGGGACTTTGGGTACGTGTGCGAAACCGAATTTCCTGCCAAAGCAGTAGCT

Numéro d'accès Ensembl | humain

ENSG00000137203

Numéro d'accès NCBI

NM_001042425

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... TFAP2A(7020) , TFAP2A(7020)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Fuchao Zhang et al.
Neurochemical research, 44(12), 2776-2785 (2019-10-28)
Transcription factors regulate the transcriptions and expressions of numerous target genes and direct a variety of physiological and pathological activities. To obtain a better understanding of the involvement of transcription factors during peripheral nerve repair and regeneration, significantly differentially expressed
Liesbeth Minnoye et al.
Genome research, 30(12), 1815-1834 (2020-08-01)
Deciphering the genomic regulatory code of enhancers is a key challenge in biology because this code underlies cellular identity. A better understanding of how enhancers work will improve the interpretation of noncoding genome variation and empower the generation of cell
Cameron C Scott et al.
eLife, 7 (2018-09-27)
How trafficking pathways and organelle abundance adapt in response to metabolic and physiological changes is still mysterious, although a few transcriptional regulators of organellar biogenesis have been identified in recent years. We previously found that the Wnt signaling directly controls

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique