Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EHU068071

Sigma-Aldrich

MISSION® esiRNA

targeting human SLC8A3

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GACCGCTTCATGGCATCTATTGAAGTCATCACCTCTCAAGAGAGGGAGGTGACAATTAAGAAACCCAATGGAGAAACCAGCACAACCACTATTCGGGTCTGGAATGAAACTGTCTCCAACCTGACCCTTATGGCCCTGGGTTCCTCTGCTCCTGAGATACTCCTCTCTTTAATTGAGGTGTGTGGTCATGGGTTCATTGCTGGTGATCTGGGACCTTCTACCATTGTAGGGAGTGCAGCCTTCAACATGTTCATCATCATTGGCATCTGTGTCTACGTGATCCCAGACGGAGAGACTCGCAAGATCAAGCATCTACGAGTCTTCTTCATCACCGCTGCTTGGAGTATCTTTGCCTACATCTGGCTCTATATGATTCTGGCAGTCTTCTCCCCTGGTGTGGTCCAGGTTTGGGAAGGCCTCCTCACTCTCTTCTTCTTTCCAGTGTGTGTCCTTCTGGCCT

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Guendalina Bastioli et al.
Cell death & disease, 10(2), 80-80 (2019-01-30)
Progressive accumulation of α-synuclein (α-syn) and exposure to environmental toxins are risk factors that may both concur to Parkinson's disease (PD) pathogenesis. Electrophysiological recordings of field postsynaptic potentials (fEPSPs) and Ca2+ measures in striatal brain slices and differentiated SH-SY5Y cells
Silvia Piccirillo et al.
Cell death & disease, 9(7), 731-731 (2018-06-30)
In brain ischemia, reduction in oxygen and substrates affects mitochondrial respiratory chain and aerobic metabolism, culminating in ATP production impairment, ionic imbalance, and cell death. The restoration of blood flow and reoxygenation are frequently associated with exacerbation of tissue injury
Giulia Di Benedetto et al.
The FEBS journal, 286(4), 737-749 (2018-12-16)
Tumor necrosis factor-related apoptosis-inducing ligand (TRAIL), a cytokine belonging to the TNF superfamily, is regarded as a mediator of neurotoxicity. The constitutively expressed ion exchanger Na+ /Ca2+ exchanger isoform-3 (NCX3) has been shown to protect neurons from injury. Its expression

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique