Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EHU067311

Sigma-Aldrich

MISSION® esiRNA

targeting human NFKB2

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

100

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

AGCAAGAGGCCAAAGAACTGAAGAAGGTGATGGATCTGAGTATAGTGCGGCTGCGCTTCTCTGCCTTCCTTAGAGCCAGTGATGGCTCCTTCTCCCTGCCCCTGAAGCCAGTCATCTCCCAGCCCATCCATGACAGCAAATCTCCGGGGGCATCAAACCTGAAGATTTCTCGAATGGACAAGACAGCAGGCTCTGTGCGGGGTGGAGATGAAGTTTATCTGCTTTGTGACAAGGTGCAGAAAGATGACATTGAGGTTCGGTTCTATGAGGATGATGAGAATGGATGGCAGGCCTTTGGGGACTTCTCTCCCACAGATGTGCATAAACAGTATGCCATTGTGTTCCGGACACCCCCCTATCACAAGATGAAGATTGAGCGGCCTGTAACAGTGTTTCTGCAACTGAAACGCAAG

Numéro d'accès Ensembl | humain

ENSG00000077150

Numéro d'accès NCBI

NM_001077494

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... NFKB2(4791) , NFKB2(4791)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Jeong Seon Kim et al.
Biochemical and biophysical research communications, 491(2), 337-342 (2017-07-25)
The NFκB family of transcription factors is crucial for innate or adaptive immunity, inflammation, and diseases including cancer. The two NFκB signaling pathways (canonical and non-canonical) differ from each other in extracellular signals, membrane receptors, signaling adaptors, and dimer subunits.
Shayna E Thomas-Jardin et al.
The Prostate, 80(2), 133-145 (2019-11-16)
The androgen receptor (AR) nuclear transcription factor is a therapeutic target for prostate cancer (PCa). Unfortunately, patients can develop resistance to AR-targeted therapies and progress to lethal disease, underscoring the importance of understanding the molecular mechanisms that underlie treatment resistance.
Laura Mondragón et al.
Cancer cell, 36(3), 268-287 (2019-08-27)
GAPDH is emerging as a key player in T cell development and function. To investigate the role of GAPDH in T cells, we generated a transgenic mouse model overexpressing GAPDH in the T cell lineage. Aged mice developed a peripheral Tfh-like lymphoma that

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique