Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EHU062211

Sigma-Aldrich

MISSION® esiRNA

targeting human PRDX5

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TGTGCTGTTTGGAGTTCCTGGGGCCTTCACCCCTGGATGTTCCAAGACACACCTGCCAGGGTTTGTGGAGCAGGCTGAGGCTCTGAAGGCCAAGGGAGTCCAGGTGGTGGCCTGTCTGAGTGTTAATGATGCCTTTGTGACTGGCGAGTGGGGCCGAGCCCACAAGGCGGAAGGCAAGGTTCGGCTCCTGGCTGATCCCACTGGGGCCTTTGGGAAGGAGACAGACTTATTACTAGATGATTCGCTGGTGTCCATCTTTGGGAATCGACGTCTCAAGAGGTTCTCCATGGTGGTACAGGATGGCATAGTGAAGGCCCTGAATGTGGAACCAGATGGCACAGGCCTCACCTGCAGCCTGGCACCCAATATCATCTCACAGCTCTGAGGCCCTGGGCCAGATTACTTCCTCCACCCCTCCCTATCTCACCTGCCCAGCCCTGTGCTGGGGCCCTGCAATTGGAATGTTGGCCAGATTT

Numéro d'accès Ensembl | humain

ENSG00000126432

Numéro d'accès NCBI

NM_181651

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... PRDX5(25824) , PRDX5(25824)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Marshall Ellison et al.
Cell communication and signaling : CCS, 18(1), 15-15 (2020-01-29)
We have previously shown that the zinc finger transcription repressor SNAI2 (SLUG) represses tumor suppressor BRCA2-expression in non-dividing cells by binding to the E2-box upstream of the transcription start site. However, it is unclear how proliferating breast cancer (BC) cells
Gui-Nan Shen et al.
Molecular medicine reports, 17(6), 7827-7834 (2018-04-06)
High concentrations of glutamate may mediate neuronal cell apoptosis by increasing intracellular reactive oxygen species (ROS) levels. Peroxiredoxin V (Prx V), a member of the Prx family, serves crucial roles in protecting cells from oxidative stress. The present study investigated
Geoffroy Walbrecq et al.
Free radical biology & medicine, 84, 215-226 (2015-03-17)
Peroxiredoxin-5 (PRDX5) is a thioredoxin peroxidase that reduces hydrogen peroxide, alkyl hydroperoxides, and peroxynitrite. This enzyme is present in the cytosol, mitochondria, peroxisomes, and nucleus in human cells. Antioxidant cytoprotective functions have been previously documented for cytosolic, mitochondrial, and nuclear

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique