Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EHU062201

Sigma-Aldrich

MISSION® esiRNA

targeting human EED

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

100

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TGGAAGTCAAAGAAATGCAAATATTCTTTCAAATGTGTAAATAGTCTCAAGGAAGATCATAACCAACCATTGTTTGGAGTTCAGTTTAACTGGCACAGTAAAGAAGGAGATCCATTAGTGTTTGCAACTGTAGGAAGCAACAGAGTTACCTTGTATGAATGTCATTCACAAGGAGAAATCCGGTTGTTGCAATCTTACGTGGATGCTGATGCTGATGAAAACTTTTACACTTGTGCATGGACCTATGATAGCAATACGAGCCATCCTCTGCTGGCTGTAGCTGGATCTAGAGGCATAATTAGGATAATAAATCCTATAACAATGCAGTGTATAAAGCACTATGTTGGCCATGGAAATGCTATCAATGAGCTGAAATTCCATCCAAGAGATCCAAATCTTCTCCTGTCAGTAAGTAAAGATCATGCTTTACGATTATGGAATATCCAGACGGACACTCTGGTGGCAATATTTGGAGG

Numéro d'accès Ensembl | humain

ENSG00000074266

Numéro d'accès NCBI

NM_152991

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... EED(8726) , EED(8726)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Bing He et al.
Oncotarget, 8(61), 103919-103930 (2017-12-22)
The miRNAs play important regulating roles in the pathogenesis of hepatocellular carcinoma (HCC). To uncover key regulating miRNAs in HCC that were neglected by traditional analyzing methods of transcriptomics data, we proposed a novel molecular-network-based omics' (MNBO) method. With this
Houliang Deng et al.
Scientific reports, 9(1), 197-197 (2019-01-19)
Chromobox 6 (CBX6) is a subunit of Polycomb Repressive Complex 1 (PRC1) that mediates epigenetic gene repression and acts as an oncogene or tumor suppressor in a cancer type-dependent manner. The specific function of CBX6 in breast cancer is currently
Qipeng Liu et al.
International journal of cancer, 145(2), 415-426 (2019-01-11)
Polycomb group proteins are important epigenetic regulators for cell proliferation and differentiation, organ development, as well as initiation and progression of lethal diseases, including cancer. Upregulated Polycomb group proteins, including Enhancer of zeste homolog 2 (EZH2), promote proliferation, migration, invasion
Seong Won Lee et al.
Developmental cell, 46(1), 73-84 (2018-07-06)
The ability to convert human somatic cells efficiently to neurons facilitates the utility of patient-derived neurons for studying neurological disorders. As such, ectopic expression of neuronal microRNAs (miRNAs), miR-9/9∗ and miR-124 (miR-9/9∗-124) in adult human fibroblasts has been found to
Weisi Liu et al.
The Journal of biological chemistry, 290(47), 28489-28501 (2015-10-08)
Our previous studies identified the oncogenic role of p21-activated kinase 1 (PAK1) in hepatocellular carcinoma (HCC) and renal cell carcinoma (RCC). Contrarily, PAK6 was found to predict a favorable prognosis in RCC patients. Nevertheless, the ambiguous tumor suppressive function of

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique