Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU061931

Sigma-Aldrich

MISSION® esiRNA

targeting human RBCK1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CTGACCCCTGAGGATTACCAGCGATTTCTAGACCTGGGCATCTCCATTGCTGAAAACCGCAGTGCCTTCAGCTACCATTGCAAGACCCCAGATTGCAAGGGATGGTGCTTCTTTGAGGATGATGTCAATGAGTTCACCTGCCCTGTGTGTTTCCACGTCAACTGCCTGCTCTGCAAGGCCATCCATGAGCAGATGAACTGCAAGGAGTATCAGGAGGACCTGGCCCTGCGGGCTCAGAACGATGTGGCTGCCCGGCAGACGACAGAGATGCTGAAGGTGATGCTGCAGCAGGGCGAGGCCATGCGCTGCCCCCAGTGCCAGATCGTGGTACAGAAGAAGGACGGCTGCGACTGGATCCGCTGCACCGTCTGCCACACCGAGATCTGCTGGGTCACCAAGGGCCCACGCTGGGGCCCTGGGGGCCCAGGAGACACCAGCGGGGGCTGCCGCTGCAGGGTAAATGGGATTCCTTGCCA

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Vous ne trouvez pas le bon produit ?  

Essayez notre Outil de sélection de produits.

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Theo Klein et al.
Nature communications, 6, 8777-8777 (2015-11-04)
Antigen receptor signalling activates the canonical NF-κB pathway via the CARD11/BCL10/MALT1 (CBM) signalosome involving key, yet ill-defined roles for linear ubiquitination. The paracaspase MALT1 cleaves and removes negative checkpoint proteins, amplifying lymphocyte responses in NF-κB activation and in B-cell lymphoma
C Donley et al.
Oncogene, 33(26), 3441-3450 (2013-08-06)
FKBPL has been implicated in processes associated with cancer, including regulation of tumor growth and angiogenesis with high levels of FKBPL prognosticating for improved patient survival. Understanding how FKBPL levels are controlled within the cell is therefore critical. We have
Julia Zinngrebe et al.
The Journal of experimental medicine, 213(12), 2671-2689 (2016-11-05)
The linear ubiquitin chain assembly complex (LUBAC), consisting of SHANK-associated RH-domain-interacting protein (SHARPIN), heme-oxidized IRP2 ubiquitin ligase-1 (HOIL-1), and HOIL-1-interacting protein (HOIP), is a critical regulator of inflammation and immunity. This is highlighted by the fact that patients with perturbed

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique