Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EHU047541

Sigma-Aldrich

MISSION® esiRNA

targeting human CDK5R1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TGCTGACATGCCTGTACCTCTCCTACTCCTACATGGGCAACGAGATCTCCTACCCGCTCAAGCCCTTCCTGGTGGAGAGCTGCAAGGAGGCCTTTTGGGACCGTTGCCTCTCTGTCATCAACCTCATGAGCTCAAAGATGCTGCAGATAAATGCCGACCCACACTACTTCACACAGGTCTTCTCCGACCTGAAGAACGAGAGCGGCCAGGAGGACAAGAAGCGGCTCCTCCTAGGCCTGGATCGGTGAGCACTGTAGCCTGCGTCATGGCTCAAGGATTCAATGCATTTTTAAGAATTTATTATTAAATCAGTTTTGTGTACAGTATGTGTCTAGCAAAGCCACCAAGGGCCTCACCTTTCCCACAGTCTCTCCCTGGGGTTTTTTTCATCCCTGCCAAGAAC

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Catégories apparentées

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Tianmei Qian et al.
Molecular and cellular biochemistry, 447(1-2), 209-215 (2018-02-02)
The proliferation and migration of Schwann cells are critical for the repair and regeneration of injured peripheral nerves. Noncoding RNAs, especially microRNAs (miRNAs), have been demonstrated to participate in regulating the biological behaviors of Schwann cells. Numerous differentially expressed novel
Silvia Moncini et al.
PloS one, 6(5), e20038-e20038 (2011-06-01)
CDK5R1 encodes p35, a specific activator of the serine/threonine kinase CDK5, which plays crucial roles in CNS development and maintenance. CDK5 activity strongly depends on p35 levels and p35/CDK5 misregulation is deleterious for correct CNS function, suggesting that a tightly

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique