Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EHU044171

Sigma-Aldrich

MISSION® esiRNA

targeting human MAPK1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TGCGCTTCAGACATGAGAACATCATTGGAATCAATGACATTATTCGAGCACCAACCATCGAGCAAATGAAAGATGTATATATAGTACAGGACCTCATGGAAACAGATCTTTACAAGCTCTTGAAGACACAACACCTCAGCAATGACCATATCTGCTATTTTCTCTACCAGATCCTCAGAGGGTTAAAATATATCCATTCAGCTAACGTTCTGCACCGTGACCTCAAGCCTTCCAACCTGCTGCTCAACACCACCTGTGATCTCAAGATCTGTGACTTTGGCCTGGCCCGTGTTGCAGATCCAGACCATGATCACACAGGGTTCCTGACAGAATATGTGGCCACACGTTGGTACAGGGCTCCAGAAATTATGTTGAATTCCAAGGGCTACACCAAGTCCATTGATATTTGGTCTGTAGGCTGCATTCTGGCAGAAATGCTTTCTAACAGGCCCATCTTTCCA

Numéro d'accès Ensembl | humain

ENSG00000100030

Numéro d'accès NCBI

NM_002745

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... MAPK1(5594) , MAPK1(5594)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Jian Zhang et al.
Experimental & molecular medicine, 49(9), e379-e379 (2017-09-25)
The objective of this study was to investigate the regulatory effects of TGF-β1 on CCL3/4 expression and inflammation-related pain during intervertebral disc degeneration (IVDD). TGF-β1 and CCL3/4 expression patterns in different degenerative human nucleus pulposus (NP) tissues were measured by
Li-Li Xu et al.
Oxidative medicine and cellular longevity, 2018, 3271617-3271617 (2018-06-12)
Ulcerative colitis (UC) is a common inflammatory bowel disease that can destroy the integrity of the colon and increase the risk of colorectal cancer. Oxidative stress is one of the critical pathogenic factors for UC, further impairing the entire affected
Susanne Ulm et al.
Journal of molecular and cellular cardiology, 72, 104-116 (2014-03-19)
Mitogen-activated protein kinases (MAPKs) are involved in the regulation of cardiac hypertrophy and myocyte survival. Extracellular signal regulated protein kinase 1 and 2 (ERK1/2) are key components in the MAPK signaling pathways. Dysfunction of ERK1/2 in congenital heart diseases (Noonan
Bishuang Cai et al.
Science signaling, 11(549) (2018-09-27)
Inflammation resolution counterbalances excessive inflammation and restores tissue homeostasis after injury. Failure of resolution contributes to the pathology of numerous chronic inflammatory diseases. Resolution is mediated by endogenous specialized proresolving mediators (SPMs), which are derived from long-chain fatty acids by
Vijay G Ramakrishnan et al.
Haematologica, 104(10), 2061-2074 (2019-03-09)
Despite recent advances in the treatment of multiple myeloma, patients with this disease still inevitably relapse and become refractory to existing therapies. Mutations in K-RAS, N-RAS and B-RAF are common in multiple myeloma, affecting 50% of patients at diagnosis and
Afficher tous les articles scientifiques apparentés

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique