Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EHU041771

Sigma-Aldrich

MISSION® esiRNA

targeting human TAX1BP1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GGTGAAATTCGTGGAGCAAGTACACCTTTCCAGTTTCGAGCTTCTTCTCCAGTTGAAGAGCTGCTTACTATGGAAGATGAAGGAAATTCTGACATGTTAGTGGTGACCACAAAAGCAGGCCTTCTTGAGTTGAAAATTGAGAAAACCATGAAAGAAAAAGAAGAACTGTTAAAGTTAATTGCCGTTCTGGAAAAAGAAACAGCACAACTTCGAGAACAAGTTGGGAGAATGGAAAGAGAACTTAACCATGAGAAAGAAAGATGTGACCAACTGCAAGCAGAACAAAAGGGTCTTACTGAAGTAACACAAAGCTTAAAAATGGAAAATGAAGAGTTTAAGAAGAGGTTCAGTGATGCTACATCCAAAGCCCATCAGCTTGAGGAAGATATTGTGTCAGTAACACATAAAGCAATTGAAAAAGAAACCGAATTAGACAGTTTAAAGGACAAACTCAAGAAGGCACA

Numéro d'accès Ensembl | humain

ENSG00000106052

Numéro d'accès NCBI

NM_006024

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... TAX1BP1(8887) , TAX1BP1(8887)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Hoyun Choi et al.
Archives of virology, 162(2), 369-377 (2016-10-21)
MicroRNAs (miRNAs) are a class of noncoding RNA molecules approximately 19 to 25 nucleotides in length that downregulate the expression of target genes at the post-transcriptional level by binding to the 3'-untranslated region (3'-UTR). Epstein-Barr virus (EBV) generates at least
Zhipeng Li et al.
Free radical biology & medicine, 153, 132-139 (2020-04-21)
Isobavachalcone (IBC) is a natural compound isolated from Fructus psoraleae. In recent years, IBC has been reported to exert anti-neuroinflammatory effect, but precise mechanisms of action remain unclear. The current study is focused on elucidating the underlying molecular mechanisms. Toward

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique