Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EHU038261

Sigma-Aldrich

MISSION® esiRNA

targeting human ZBTB33

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

ATCGACTGGTTGCAAGGTTTATGCAAATATCGGTGAAGATACTTATGATATAGTGATCCCTGTCAAAGATGACCCTGATGAAGGGGAGGCCAGACTTGAGAATGAAATACCAAAAACGTCTGGCAGCGAGATGGCAAACAAACGTATGAAAGTAAAACATGATGATCACTATGAGTTAATAGTAGATGGAAGGGTCTATTATATCTGTATTGTATGCAAAAGGTCATATGTCTGTCTGACAAGCTTGCGGAGACATTTTAACATTCATTCTTGGGAGAAGAAGTATCCGTGCCGTTACTGTGAGAAGGTATTTCCTCTTGCAGAATATCGCACAAAGCATGAAATTCATCACACAGGGGAGCGAAGGTATCAGTGTTTGGCCTGTGGCAAATCTTTCATCAACTATCAGTTTATGTCTTCACATATAAAGTCAGTTCATAGTCAAGATCCTTCTGGGGACTCAAAGCT

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Ligang Wang et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 48(3), 947-958 (2018-07-24)
Kaiso (ZBTB33) expression is closely associated with the progression of many cancers and microRNA (miRNA) processing. MiR-181a plays critical roles in multiple cancers; however, its precise mechanisms in glioma have not been well clarified. The goal of this study was
Jacqueline Jones et al.
Clinical & experimental metastasis, 31(5), 497-510 (2014-02-27)
The expression and biological consequences of Kaiso, a novel bi-modal transcription factor, in infiltrating ductal carcinomas (IDCs) have not been widely investigated. In the present study, we determined Kaiso expression and subcellular localization in 146 normal tissues, 376 IDCs, and

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique