Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EHU035251

Sigma-Aldrich

MISSION® esiRNA

targeting human KCNN4

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GAGAGGCAGGCTGTTAATGCCACTGGGCACCTTTCAGACACACTTTGGCTGATCCCCATCACATTCCTGACCATCGGCTATGGTGACGTGGTGCCGGGCACCATGTGGGGCAAGATCGTCTGCCTGTGCACTGGAGTCATGGGTGTCTGCTGCACAGCCCTGCTGGTGGCCGTGGTGGCCCGGAAGCTGGAGTTTAACAAGGCAGAGAAGCACGTGCACAACTTCATGATGGATATCCAGTATACCAAAGAGATGAAGGAGTCCGCTGCCCGAGTGCTACAAGAAGCCTGGATGTTCTACAAACATACTCGCAGGAAGGAGTCTCATGCTGCCCGCAGGCATCAGCGCAAGCTGCTGGCCGCCATCAACGCGTTCCGCCAGGTGCGGCTGAAACACCGGAAGCTCCGGGAACAAGTGAACTCCATGGTGGACATCTCCAAGATGCACATGATCCTGTATGACCTGCAGCAGA

Numéro d'accès Ensembl | humain

ENSG00000104783

Numéro d'accès NCBI

NM_002250

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... KCNN4(3783) , KCNN4(3783)

Catégories apparentées

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Yu-Dong Fei et al.
Theranostics, 9(22), 6396-6411 (2019-10-08)
Effective therapeutic targets against post-myocardial infarction (MI) arrhythmias remain to be discovered. We aimed to investigate the role of macrophages in post-MI arrhythmias. Methods: Mononuclear cell accumulation, macrophage polarization from M0 to M1 subset, and gap junction formation were analyzed
Alban Girault et al.
Respiratory research, 16, 100-100 (2015-09-04)
Extensive alveolar epithelial injury and remodelling is a common feature of acute lung injury and acute respiratory distress syndrome (ARDS) and it has been established that epithelial regeneration, and secondary lung oedema resorption, is crucial for ARDS resolution. Much evidence
Chunling Huang et al.
Scientific reports, 6, 23884-23884 (2016-04-01)
Autophagy is emerging as an important pathway in many diseases including diabetic nephropathy. It is acknowledged that oxidative stress plays a critical role in autophagy dysfunction and diabetic nephropathy, and KCa3.1 blockade ameliorates diabetic renal fibrosis through inhibiting TGF-β1 signaling
Yu Liu et al.
Journal of Cancer, 6(7), 643-651 (2015-06-17)
The intermediate conductance calcium-activated potassium channel KCa3.1 plays an important role in regulating cell proliferation and migration. However, the role of KCa3.1 channel in human hepatocellular carcinoma remained unknown. This study was therefore performed to investigate the effects of KCa3.1
Etmar Bulk et al.
Oncotarget, 8(68), 112268-112282 (2018-01-20)
Early metastasis leads to poor prognosis of lung cancer patients, whose 5-year survival rate is only 15%. We could recently show that the Ca2+ sensitive K+ channel KCa3.1 promotes aggressive behavior of non-small cell lung cancer (NSCLC) cells and that

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique