Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EHU033981

Sigma-Aldrich

MISSION® esiRNA

targeting human COPB2

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TACAGAGCCATGGATGTTGGCAAGTCTTTACAATGGCAGTGTGTGTGTTTGGAATCATGAAACACAGACACTGGTGAAGACATTTGAAGTATGTGATCTTCCTGTTCGAGCTGCAAAGTTTGTTGCAAGGAAGAATTGGGTTGTGACAGGAGCGGATGACATGCAGATTAGAGTGTTCAATTACAATACTCTGGAGAGAGTTCATATGTTTGAAGCACACTCAGACTACATTCGCTGTATTGCTGTTCATCCAACCCAGCCTTTCATTCTAACTAGCAGTGATGACATGCTTATTAAGCTCTGGGACTGGGATAAAAAATGGTCTTGCTCACAAGTGTTTGAAGGACACACCCATTATGTTATGCAGATTGTGATCAACCCCAAAGATAACAATCAGTTTGCCAGTGCCTCT

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Eleni G Christodoulou et al.
Oncotarget, 8(21), 34283-34297 (2017-04-19)
Mutated KRAS plays an important role in many cancers. Although targeting KRAS directly is difficult, indirect inactivation via synthetic lethal partners (SLPs) is promising. Yet to date, there are no SLPs from high-throughput RNAi screening, which are supported by multiple
Rene Raphemot et al.
Cell chemical biology, 26(9), 1253-1262 (2019-07-02)
Plasmodium parasites undergo an obligatory and asymptomatic developmental stage within the liver before infecting red blood cells to cause malaria. The hijacked host pathways critical to parasite infection during this hepatic phase remain poorly understood. Here, we implemented a forward

Protocoles

Coronavirus qPCR Primer and probe sets for the detection of SARS-CoV-2 (Corona Virus), with additional real-time RT-PCR, RT-qPCR and supporting reagents available.

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique