Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EHU031131

Sigma-Aldrich

MISSION® esiRNA

targeting human SUB1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

100

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TCAAGCTCTTCTGGCAGTGATTCTGACAGTGAGGTTGACAAAAAGTTAAAGAGGAAAAAGCAAGTTGCTCCAGAAAAACCTGTAAAGAAACAAAAGACAGGTGAGACTTCGAGAGCCCTGTCATCTTCTAAACAGAGCAGCAGCAGCAGAGATGATAACATGTTTCAGATTGGGAAAATGAGGTACGTTAGTGTTCGCGATTTTAAAGGCAAAGTGCTAATTGATATTAGAGAATATTGGATGGATCCTGAAGGTGAAATGAAACCAGGAAGAAAAGGTATTTCTTTAAATCCAGAACAATGGAGCCAGCTGAAGGAACAGATTTCTGACATTGATGATGCAGTAAGAAAACTGTAAAATTCGAGCCATATAAATAAAACCTGTACTGTTCTAGTTGTTTTAATCTGTCTTTTTACATTGGCTTTTGTTTTCTAAATGTTCTCCAAGCTATTGTATGTTTGGATTGCAGAAGAATTTG

Numéro d'accès Ensembl | humain

ENSG00000113387

Numéro d'accès NCBI

NM_006713

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... SUB1(10923) , SUB1(10923)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

B V S K Chakravarthi et al.
Oncogene, 35(49), 6330-6340 (2016-06-09)
MicroRNA-101, a tumor suppressor microRNA (miR), is often downregulated in cancer and is known to target multiple oncogenes. Some of the genes that are negatively regulated by miR-101 expression include histone methyltransferase EZH2 (enhancer of zeste homolog 2), COX2 (cyclooxygenase-2)
Shaolin Tao et al.
American journal of cancer research, 5(6), 1878-1889 (2015-08-14)
Human transcriptional positive cofactor 4 (PC4) is a novel marker for diagnosis and treatment of advanced human cancers metastasis. In human lung adenocarcinoma, tumor lymphangiogenesis, an important early event, can promotes lymphatic metastasis, while it has been reported that VEGF-C/VEGF-D/VEGFR-3
Shin-Hee Heo et al.
Cancer letters, 362(1), 139-148 (2015-04-02)
All-trans retinoic acid (ATRA), the most biologically active metabolite of vitamin A, has been extensively studied for the prevention and treatment of cancer; however, the underlying mechanism of its anti-cancer potential is still unclear. Here we found that ATRA induces
Young Lan Seo et al.
The Journal of general virology, 96(Pt 4), 822-832 (2014-12-24)
Infection with hepatitis C virus (HCV) is characterized by systemic oxidative stress that is caused by either viral core protein or chronic inflammation. It is well recognized that reactive oxygen species (ROS) such as H2O2 can induce apoptotic cell death

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique