Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU028861

Sigma-Aldrich

MISSION® esiRNA

targeting human IGF1R

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

100

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

AGGATGCACCATCTTCAAGGGCAATTTGCTCATTAACATCCGACGGGGGAATAACATTGCTTCAGAGCTGGAGAACTTCATGGGGCTCATCGAGGTGGTGACGGGCTACGTGAAGATCCGCCATTCTCATGCCTTGGTCTCCTTGTCCTTCCTAAAAAACCTTCGCCTCATCCTAGGAGAGGAGCAGCTAGAAGGGAATTACTCCTTCTACGTCCTCGACAACCAGAACTTGCAGCAACTGTGGGACTGGGACCACCGCAACCTGACCATCAAAGCAGGGAAAATGTACTTTGCTTTCAATCCCAAATTATGTGTTTCCGAAATTTACCGCATGGAGGAAGTGACGGGGACTAAAGGGCGCCAAAGCAAAGGGGACATAAACACCAGGAACAACGGGGAGAGAGCCTCCTGTGAAAGTGACGTCCTGCATTTCACCTCCACCACCACGTCGAAGAATCGCATCATCATAACCTGGCACCGGTA

Numéro d'accès Ensembl | humain

ENSG00000140443

Numéro d'accès NCBI

NM_000875

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... IGF1R(3480) , IGF1R(3480)

Catégories apparentées

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Vous ne trouvez pas le bon produit ?  

Essayez notre Outil de sélection de produits.

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number
ACNV
QCS
IYT
XUT
BPT

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Rechercher un(e) COA

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Lu Chen et al.
OncoTargets and therapy, 12, 907-919 (2019-02-19)
A variety of microRNAs (miRNAs) are aberrantly expressed in acute myeloid leukemia (AML), and these dysregulated miRNAs perform crucial roles in tumorigenesis and progression of AML. miR-628-3p (miR-628), one of the miRNAs dysregulated in multiple types of human cancers, exerts
Bao-Feng Li et al.
Human cell, 30(4), 311-318 (2017-08-11)
In recent years, some studies have been made on the effects of circular RNA (circRNA) in osteoarthritis (OA) and so on; however, its mechanisms remain to be further explored. Studies have shown that tumor necrosis factor-alpha can inhibit hsa_circ_0045714 expression
Tomokazu Ohnuma et al.
Archives of biochemistry and biophysics, 635, 66-73 (2017-10-21)
Many lines of evidence demonstrate that transcription factor nuclear factor-E2-related factor 2 (Nrf2) plays essential roles in cancer cell proliferation and resistance to chemotherapy, thereby indicating that suppression of abnormal Nrf2 activation is needed for a new therapeutic approach. Our
Li-Li Mei et al.
Cancer biomarkers : section A of Disease markers, 20(4), 527-537 (2017-08-12)
miR-99a is down-regulated in esophageal squamous cell carcinoma (ESCC), however the role and underlying mechanism are still unknown. We aim to explore the role and mechanism of miR-99a down-regulation in ESCC. The expression of miR-99a in ESCC tissues and cell
Yann Neuzillet et al.
BMC cancer, 17(1), 636-636 (2017-09-09)
The insulin growth factor (IGF) pathway has been proposed as a potential therapeutic target in bladder cancer. We characterized the expression of components of the IGF pathway - insulin growth factor receptors (INSR, IGF1R, IGF2R), ligands (INS, IGF1, IGF2), and
Afficher tous les articles scientifiques apparentés

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique