Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EHU026341

Sigma-Aldrich

MISSION® esiRNA

targeting human GLI1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GCCCAATCACAAGTCAGGTTCCTATCCCACCCCTTCACCATGCCATGAAAATTTTGTAGTGGGGGCAAATAGGGCTTCACATAGGGCAGCAGCACCACCTCGACTTCTGCCCCCATTGCCCACTTGCTATGGGCCTCTCAAAGTGGGAGGCACAAACCCCAGCTGTGGTCATCCTGAGGTGGGCAGGCTAGGAGGGGGTCCTGCCTTGTACCCTCCTCCCGAAGGACAGGTATGTAACCCCCTGGACTCTCTTGATCTTGACAACACTCAGCTGGACTTTGTGGCTATTCTGGATGAGCCCCAGGGGCTGAGTCCTCCTCCTTCCCATGATCAGCGGGGCAGCTCTGGACATACCCCACCTCCCTCTGGGCCCCCCAACATGGCTGTGGGCAACATGAGTGTCTTACTGAGATCCCTACCTGGGGAAACAGAATTCCTCAACTCTAGTGCCTAAAGAGTAGGGAATCTCATCCATCACAGATCGCAT

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Yang Chong et al.
Journal of experimental & clinical cancer research : CR, 35(1), 175-175 (2016-11-12)
Gastric cancer (GC) is characterized by the excessive deposition of extracellular matrix, which is thought to contribute to this tumor's malignant behavior. Epithelial-mesenchymal transition (EMT) is regarded as a crucial contributing factor to cancer progression. Galectin-1 (Gal-1), a β-galactoside-binding protein
Xinyi Cai et al.
OncoTargets and therapy, 8, 877-883 (2015-05-07)
The Hedgehog (Hh) signaling pathway not only plays important roles in embryogenesis and adult tissue homeostasis, but also in tumorigenesis. Aberrant Hh pathway activation has been reported in a variety of malignant tumors including colon carcinoma. Here, we sought to
Hyungsin Kim et al.
Cancers, 11(9) (2019-09-08)
Despite the presence of aggressive treatment strategies, glioblastoma remains intractable, warranting a novel therapeutic modality. An oral antipsychotic agent, penflurido (PFD), used for schizophrenia treatment, has shown an antitumor effect on various types of cancer cells. As glioma sphere-forming cells
Yumei Diao et al.
Molecular oncology, 12(10), 1718-1734 (2018-08-12)
Hedgehog (HH) signaling is involved in many physiological processes, and pathway deregulation can result in a wide range of malignancies. Glioma-associated oncogene 1 (GLI1) is a transcription factor and a terminal effector of the HH cascade. Despite its crucial role
Guodong Zhang et al.
Experimental and therapeutic medicine, 19(4), 2913-2922 (2020-04-08)
The efficacy of ginsenoside Rh2 (Rh2) in cancer therapy has been reported; however, its function in lung cancer remains unknown. To analyze the role of Rh2 in the inhibition of lung cancer cell proliferation in the present study, protein expression

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique