Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EHU024631

Sigma-Aldrich

MISSION® esiRNA

targeting human SMPD3

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GGACGTGGCCTATCACTGTTACCCCAACAAGTGTAACGACGATGCCCTGGCCTCTAAGGGAGCTCTGTTTCTCAAGGTGCAGGTGGGAAGCACACCTCAGGACCAAAGAATCGTCGGGTACATCGCCTGCACACACCTGCATGCCCCGCAAGAGGACAGCGCCATCCGGTGTGGGCAGCTGGACCTGCTTCAGGACTGGCTGGCTGATTTCCGAAAATCTACCTCCTCGTCCAGCGCAGCCAACCCCGAGGAGCTGGTGGCATTTGACGTCGTCTGTGGAGATTTCAACTTTGATAACTGCTCCTCTGACGACAAGCTGGAGCAGCAACACTCCCTGTTCACCCACTACAGGGACCCCTGCCGCCTGGGGCCTGGTGAGGAGAAGCCGTGGGCCATCGGTACTCTGCTGGACACGAACG

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

James Lawson et al.
Oncotarget, 8(48), 83913-83924 (2017-11-16)
Extracellular vesicles (EVs) are key signaling mediators between cancer cells and their supporting stroma, and regulate critical processes such as invasion, metastases, and angiogenesis. We have identified a subset of miRNAs (miR-142-3p, miR-143-3p, miR-145-5p, miR-150-5p, miR-223-3p, miR-451a, miR-486-5p, miR-605-5p) that
Kyle I Mentkowski et al.
American journal of physiology. Heart and circulatory physiology, 318(6), H1447-H1460 (2020-04-25)
Macrophages play a pivotal role in tissue repair following myocardial infarction (MI). In response to injury, they exist along a spectrum of activation states tightly regulated by their microenvironment. Cardiosphere-derived cells (CDCs) have been shown to mediate cardioprotection via modulation
Ji Na Kong et al.
International journal of cancer, 137(7), 1610-1620 (2015-04-03)
Many breast cancer cells acquire multidrug resistance (MDR) mediated by ABC transporters such as breast cancer resistance protein (BCRP/ABCG2). Here we show that incubation of human breast cancer MDA-MB-231 cells with farnesoid X receptor antagonist guggulsterone (gug) and retinoid X

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique