Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU024471

Sigma-Aldrich

MISSION® esiRNA

targeting human FADD

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GGCTCGTCAGCTCAAAGTCTCAGACACCAAGATCGACAGCATCGAGGACAGATACCCCCGCAACCTGACAGAGCGTGTGCGGGAGTCACTGAGAATCTGGAAGAACACAGAGAAGGAGAACGCAACAGTGGCCCACCTGGTGGGGGCTCTCAGGTCCTGCCAGATGAACCTGGTGGCTGACCTGGTACAAGAGGTTCAGCAGGCCCGTGACCTCCAGAACAGGAGTGGGGCCATGTCCCCGATGTCATGGAACTCAGACGCATCTACCTCCGAAGCGTCCTGATGGGCCGCTGCTTTGCGCTGGTGGACCACAGGCATCTACACAGCCTGGACTTTGGTTCTCTCCAGGAAGGTAGCCCAGCACTGTGAAGACCCAGCAGGAAGCCAGGCTGAGTGAGCCACAGACCACCTGCTTCTGA

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Christiana G Savva et al.
BMC cancer, 16, 279-279 (2016-04-22)
Acquired resistance towards apoptosis is a hallmark of cancer. Elimination of cells bearing activated oncogenes or stimulation of tumor suppressor mediators may provide a selection pressure to overcome resistance. KC-53 is a novel biyouyanagin analogue known to elicit strong anti-inflammatory
Shih-Wei Wang et al.
Molecular carcinogenesis, 57(7), 866-877 (2018-03-23)
Luteolin (3',4',5,7-tetrahydroxyflavone), which exists in fruits, vegetables, and medicinal herbs, is used in Chinese traditional medicine for treating various diseases, such as hypertension, inflammatory disorders, and cancer. However, the gene-regulatory role of luteolin in cancer prevention and therapy has not
Zongliang Lu et al.
International journal of oncology, 56(2), 439-447 (2020-01-03)
Ophiopogonin D' (OPD') is a natural compound extracted from Ophiopogon japonicus, which is a plant used in traditional Chinese medicine. Our previous study has indicated that OPD' exhibits antitumor activity against androgen‑independent prostate cancer (PCa), but the effects and the
Fangfang Cai et al.
Cell death & disease, 11(1), 33-33 (2020-01-18)
Hydrogen sulfide (H2S) is now widely considered the third endogenous gasotransmitter and plays critical roles in cancer biological processes. In this study, we demonstrate that 5-(4-hydroxyphenyl)-3H-1,2-dithiole-3-thione (ADT-OH), the most widely used moiety for synthesising slow-releasing H2S donors, induces melanoma cell
Liang-Jun Wang et al.
Biochemical pharmacology, 162, 154-168 (2018-11-11)
Albendazole (ABZ) is a microtubule-targeting anthelmintic that acts against a variety of human cancer cells, but the dependence of its cytotoxicity on non-mitotic effect remains elusive. Thus, we aimed to explore the mechanistic pathway underlying the cytotoxicity of ABZ in

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique