Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

Autres documents

EHU016971

Sigma-Aldrich

MISSION® esiRNA

targeting human MMP2

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

100

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TTGGCAGTGCAATACCTGAACACCTTCTATGGCTGCCCCAAGGAGAGCTGCAACCTGTTTGTGCTGAAGGACACACTAAAGAAGATGCAGAAGTTCTTTGGACTGCCCCAGACAGGTGATCTTGACCAGAATACCATCGAGACCATGCGGAAGCCACGCTGCGGCAACCCAGATGTGGCCAACTACAACTTCTTCCCTCGCAAGCCCAAGTGGGACAAGAACCAGATCACATACAGGATCATTGGCTACACACCTGATCTGGACCCAGAGACAGTGGATGATGCCTTTGCTCGTGCCTTCCAAGTCTGGAGCGATGTGACCCCACTGCGGTTTTCTCGAATCCATGATGGAGAGGCAGACATCATGATCAACTTTGGCCGCTGGGAGCATGGCGATGGATACCCCTTTGACGGTAAGGACGGACTC

Numéro d'accès Ensembl | humain

ENSG00000087245

Numéro d'accès NCBI

NM_004530

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... MMP2(4313) , MMP2(4313)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Xi Cheng et al.
Scientific reports, 7(1), 12362-12362 (2017-09-30)
Studies indicate that the chemokine receptor is responsible for poor prognosis of hepatocellular carcinoma (HCC) patients. In this study, we initially demonstrated that CCR4 is overexpressed in HCC specimens, and its elevation in HCC tissues positively correlates with tumor capsule
Yonghao Gu et al.
Ophthalmic research, 55(2), 70-75 (2015-11-28)
Proliferative retinal angiogenesis may severely impair the retina. Previous studies have indicated that matrix metalloproteinase (MMP)-2 and MMP-9 play important roles in the process of retinal angiogenesis. In this study, we suppressed MMP-2 and MMP-9 expression with RNA interference (RNAi)
Qiong Pan et al.
Placenta, 53, 48-53 (2017-05-11)
Preeclampsia (PE) is a serious pregnancy-related syndrome, which is characterized by gestational hypertension and proteinuria. The microRNA-93 (miR-93) is upregulated in the maternal plasma of patients with PE. However, the functional role of miR-93 in PE remains unknown. Here, we
Tingting Ren et al.
American journal of translational research, 9(6), 2824-2837 (2017-07-04)
Human malignant hepatocellular carcinoma (HCC) is a common tumor, which severely threatens human health and shortens longevity. The poor prognosis of HCC is primarily attributed to distant metastases. C-X-C motif chemokine 10 (CXCL10) regulates the control of several cellular and
Hui-Li Lu et al.
Molecular carcinogenesis, 55(12), 2106-2120 (2016-01-13)
The p85α subunit of phosphatidylinositol 3-kinase (PI3K) acts as a key regulator of cell proliferation and motility, which mediates signals that confer chemoresistance to many human cancer cells. Using small interfering RNAs against matrix metalloproteinase-2 (MMP-2) and the MMP-2 promoter-driven
Afficher tous les articles scientifiques apparentés

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique