Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

View All Documentation

EHU016671

Sigma-Aldrich

MISSION® esiRNA

targeting human PFKP

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

AGAGGCCTTGTGCTCAGAAATGAGAGCTGCAGTGAAAACTACACCACCGACTTCATTTACCAGCTGTATTCAGAAGAGGGCAAAGGCGTGTTTGACTGCAGGAAGAACGTGCTGGGTCACATGCAGCAGGGTGGGGCACCCTCTCCATTTGATAGAAACTTTGGAACCAAAATCTCTGCCAGAGCTATGGAGTGGATCACTGCAAAACTCAAGGAGGCCCGGGGCAGAGGAAAAAAATTTACCACCGATGATTCCATTTGTGTGCTGGGAATAAGCAAAAGAAACGTTATTTTTCAACCTGTGGCAGAGCTGAAGAAGCAAACGGATTTTGAGCACAGGATTCCCAAAGAACAGTGGTGGCTCAAGCTACGGCCCCTCATGAAAATCCTGGCCAAGTACAAGGCCAGCTATGACGTGTCGGACTCA

Numéro d'accès Ensembl | humain

ENSG00000067057

Numéro d'accès NCBI

NM_002627

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... PFKP(5214) , PFKP(5214)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Sheikh Mohammad Umar et al.
Experimental cell research, 396(1), 112282-112282 (2020-09-14)
In the present study, we have explored the prognostic value of the Phosphofructokinase Platelet-type (PFKP) expression and its therapeutic relevance in metastatic breast cancer. PFKP immunohistochemistry was performed on Invasive ductal carcinomas (IDCs; n = 87) of breast, and its association with
Chandra Prakash Prasad et al.
Oncotarget, 8(42), 71471-71488 (2017-10-27)
Here we investigated the impact of WNT5A signaling on aerobic glycolysis and evaluated its effects on breast cancer cell migration/invasion. WNT5A signaling reduced migration and lactate production and caused selective down-regulation of the glycolytic enzyme phosphofructokinase platelet-type (PFKP). These events

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique