Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

Autres documents

EHU015391

Sigma-Aldrich

MISSION® esiRNA

targeting human PARN

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

100

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

ATGTTTTCCCGAAACCCTTCAATAGATCCTCACCAGATGTCAAATTTGTTTGTCAGAGCTCCAGCATTGACTTTCTAGCAAGCCAGGGATTTGATTTTAATAAAGTTTTTCGAAATGGAATTCCATATTTAAATCAGGAAGAAGAAAGACAGTTAAGAGAGCAGTATGATGAAAAACGTTCACAGGCGAATGGTGCAGGAGCTCTGTCCTATGTATCTCCTAACACTTCAAAATGTCCTGTCACGATTCCTGAGGATCAAAAGAAGTTTATTGACCAAGTGGTAGAGAAAATAGAGGATTTATTACAAAGTGAAGAAAACAAGAACTTGGATTTAGAGCCATGTACCGGGTTCCAAAGAAAACTAATTTATCAGACTTTGAGCTGGAAGTATCCGAAAGGCATTCATGTTGAGACTTTAGAAACTGAAAAGAAGGAGCGATATATAGTTATCAGCAAAGTAGATGAAGAAGAACGCAAAAGAAGAGAGCAGCAGAAACATGCCAAAGA

Numéro d'accès Ensembl | humain

ENSG00000140694

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... PARN(5073) , PARN(5073)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Blanca Nieto et al.
Nature communications, 11(1), 156-156 (2020-01-11)
Technical problems intrinsic to the purification of preribosome intermediates have limited our understanding of ribosome biosynthesis in humans. Addressing this issue is important given the implication of this biological process in human disease. Here we report a preribosome purification and
Penelope Kroustallaki et al.
Cell reports, 28(7), 1690-1702 (2019-08-15)
Telomerase biogenesis is a complex process where several steps remain poorly understood. Single-strand-selective uracil-DNA glycosylase (SMUG1) associates with the DKC1-containing H/ACA ribonucleoprotein complex, which is essential for telomerase biogenesis. Herein, we show that SMUG1 interacts with the telomeric RNA component

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique