Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

View All Documentation

EHU010391

Sigma-Aldrich

MISSION® esiRNA

targeting human CTSK

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CCTTGAGGCTTCTCTTGGTGTCCATACATATGAACTGGCTATGAACCACCTGGGGGACATGACCAGTGAAGAGGTGGTTCAGAAGATGACTGGACTCAAAGTACCCCTGTCTCATTCCCGCAGTAATGACACCCTTTATATCCCAGAATGGGAAGGTAGAGCCCCAGACTCTGTCGACTATCGAAAGAAAGGATATGTTACTCCTGTCAAAAATCAGGGTCAGTGTGGTTCCTGTTGGGCTTTTAGCTCTGTGGGTGCCCTGGAGGGCCAACTCAAGAAGAAAACTGGCAAACTCTTAAATCTGAGTCCCCAGAACCTAGTGGATTGTGTGTCTGAGAATGATGGCTGTGGAGGGGGCTACATGACCAATGCCTTCCAATATGTGCAGAAGAACCGGGGTATTGACTCTGAAGATGCCTACCCATATGTGGG

Numéro d'accès Ensembl | humain

ENSG00000143387

Numéro d'accès NCBI

NM_000396

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... CTSK(1513) , CTSK(1513)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Weiping Liang et al.
Journal of cancer research and clinical oncology, 145(8), 1999-2012 (2019-06-07)
The processes of prostate cancer (PCa) invasion and metastasis are facilitated by proteolytic cascade involving multiple proteases, such as matrix metalloproteinases, serine proteases and cysteine proteases including cathepsin K (CatK). CatK is predominantly secreted by osteoclasts and specifically degrades collagen
Fen Liu et al.
Journal of tissue engineering and regenerative medicine, 11(10), 2922-2934 (2016-07-13)
Recent studies have shown that patients with pycnodysostosis caused by cathepsin K (CTSK) genetic mutations exhibit significantly abnormal periodontal hard tissue structure. This finding suggests that CTSK may play a role in regulating the development of alveolar bone and cementum.

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique