Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU009621

Sigma-Aldrich

MISSION® esiRNA

targeting human ERRFI1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

ACCAGCTGGCTCCTTTAACAAGCCAGCCATAAGGATATCCAACTGTTGTATACACAGAGCTTCTCCTAACTCCGATGAAGACAAACCTGAGGTTCCCCCCAGAGTTCCCATACCTCCTAGACCAGTAAAGCCAGATTATAGAAGATGGTCAGCAGAAGTTACTTCGAGCACCTATAGTGATGAAGACAGGCCTCCCAAAGTACCGCCAAGAGAACCTTTGTCACCGAGTAACTCGCGCACACCGAGTCCCAAAAGCCTTCCGTCTTACCTCAATGGGGTCATGCCCCCGACACAGAGCTTTGCCCCTGATCCCAAGTATGTCAGCAGCAAAGCACTGCAAAGACAGAACAGCGAAGGATCTGCCAGTAAGGTTCCTTGCATTCTGCCCATTATTGAAAATGGGAAGAAGGTTAGTTCAACACATTATTACCTACTACCTGAACGACCACCATACCTGGACAAATATGAAAAATTTTTTAGGGAAGCAGAAGAAACAAATGGAGGCGCCCAAATCCAGCCATTACCTGCTG

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Vous ne trouvez pas le bon produit ?  

Essayez notre Outil de sélection de produits.

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Da Hyun Kang et al.
BMC cancer, 20(1), 571-571 (2020-06-20)
The resistance of lung cancer to epidermal growth factor receptor-tyrosine kinase inhibitor (EGFR-TKI) is one of the unconquered frontiers in chemotherapy. Mitogen-inducible gene 6 (Mig-6) is known to inhibit the kinase activity of epidermal growth factor receptor (EGFR). Similarly, numerous
Soyoung Park et al.
Oncotarget, 7(8), 8916-8930 (2016-01-14)
Hexavalent Chromium [Cr(VI)] compounds are human lung carcinogens and environmental/occupational hazards. The molecular mechanisms of Cr(VI) carcinogenesis appear to be complex and are poorly defined. In this study, we investigated the potential role of Gene 33 (ERRFI1, Mig6), a multifunctional
Zixuan Li et al.
Experimental and molecular pathology, 102(3), 492-499 (2017-05-17)
The ablation of Mig-6 has been shown to induce tumor formation in various tissues. However, the relationships between Mig-6 expression, clinical pathological factors, and prognosis have not been clarified in hepatocellular carcinoma (HCC), and the mechanism by which Mig-6 regulates
Malgorzata Milewska et al.
PloS one, 10(6), e0129859-e0129859 (2015-06-13)
BRAF functions in the RAS-extracellular signal-regulated kinase (ERK) signaling cascade. Activation of this pathway is necessary to mediate the transforming potential of oncogenic BRAF, however, it may also cause a negative feedback that inhibits the epidermal growth factor receptor (EGFR).

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique