Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

Autres documents

EHU008751

Sigma-Aldrich

MISSION® esiRNA

targeting human EPAS1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GGGCCAGGTGAAAGTCTACAACAACTGCCCTCCTCACAATAGTCTGTGTGGCTACAAGGAGCCCCTGCTGTCCTGCCTCATCATCATGTGTGAACCAATCCAGCACCCATCCCACATGGACATCCCCCTGGATAGCAAGACCTTCCTGAGCCGCCACAGCATGGACATGAAGTTCACCTACTGTGATGACAGAATCACAGAACTGATTGGTTACCACCCTGAGGAGCTGCTTGGCCGCTCAGCCTATGAATTCTACCATGCGCTAGACTCCGAGAACATGACCAAGAGTCACCAGAACTTGTGCACCAAGGGTCAGGTAGTAAGTGGCCAGTACCGGATGCTCGCAAAGCATGGGGGCTACGTGTGGCTGGAGACCCAGGGGACGGTCATCTACAACCCTCGCAACCTGCAGCCCCAGTGCATCATGTGTGTCA

Numéro d'accès Ensembl | humain

ENSG00000116016

Numéro d'accès NCBI

NM_001430

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... EPAS1(2034) , EPAS1(2034)

Catégories apparentées

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Seungyeul Yoo et al.
PLoS genetics, 11(1), e1004898-e1004898 (2015-01-09)
Chronic Obstructive Pulmonary Disease (COPD) is a complex disease. Genetic, epigenetic, and environmental factors are known to contribute to COPD risk and disease progression. Therefore we developed a systematic approach to identify key regulators of COPD that integrates genome-wide DNA
Olga Roche et al.
Nucleic acids research, 44(19), 9315-9330 (2016-11-02)
A wide range of diseases course with an unbalance between the consumption of oxygen by tissues and its supply. This situation triggers a transcriptional response, mediated by the hypoxia inducible factors (HIFs), that aims to restore oxygen homeostasis. Little is
Shirley Dehn et al.
Journal of immunology (Baltimore, Md. : 1950), 197(9), 3639-3649 (2016-09-28)
Hypoxia-inducible factor (HIF)-α isoforms regulate key macrophage (MΦ) functions during ischemic inflammation. HIF-2α drives proinflammatory cytokine production; however, the requirements for HIF-2α during other key MΦ functions, including phagocytosis, are unknown. In contrast to HIF-1α, HIF-2α was not required for
Maria Lucibello et al.
Oncotarget, 6(7), 5275-5291 (2015-03-18)
Upregulation of Translationally Controlled Tumor Protein (TCTP) is associated with poorly differentiated aggressive tumors, including breast cancer, but the underlying mechanism(s) are still debated. Here, we show that in breast cancer cell lines TCTP is primarily localized in the nucleus

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique