Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU008151

Sigma-Aldrich

MISSION® esiRNA

targeting human FABP3

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

AGCCTAGCCCAGCATCACTATGGTGGACGCTTTCCTGGGCACCTGGAAGCTAGTGGACAGCAAGAATTTCGATGACTACATGAAGTCACTCGGTGTGGGTTTTGCTACCAGGCAGGTGGCCAGCATGACCAAGCCTACCACAATCATCGAAAAGAATGGGGACATTCTCACCCTAAAAACACACAGCACCTTCAAGAACACAGAGATCAGCTTTAAGTTGGGGGTGGAGTTCGATGAGACAACAGCAGATGACAGGAAGGTCAAGTCCATTGTGACACTGGATGGAGGGAAACTTGTTCACCTGCAGAAATGGGACGGGCAAGAGACCACACTTGTGCGGGAGCTAATTGATGGAAAACTCATCCTGACACTCACCCACGGCACTGCAGTTTGCACTCGCACTTATGAGAAAGAGGCATGACCTGACTGCACTGT

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Vous ne trouvez pas le bon produit ?  

Essayez notre Outil de sélection de produits.

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Seung-Min Lee et al.
Nature communications, 11(1), 5661-5661 (2020-11-11)
Sarcopenia is characterized by decreased skeletal muscle mass and function with age. Aged muscles have altered lipid compositions; however, the role and regulation of lipids are unknown. Here we report that FABP3 is upregulated in aged skeletal muscles, disrupting homeostasis
Vadim Le Joncour et al.
EMBO molecular medicine, 11(6) (2019-05-10)
The current clinical care of glioblastomas leaves behind invasive, radio- and chemo-resistant cells. We recently identified mammary-derived growth inhibitor (MDGI/FABP3) as a biomarker for invasive gliomas. Here, we demonstrate a novel function for MDGI in the maintenance of lysosomal membrane

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique