Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU006001

Sigma-Aldrich

MISSION® esiRNA

targeting human FANCF

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

ACCCAAATCTCCAGGAGGACTCTCTGATGAAGACCCAGGCGGAGCTGCTGCTGGAGCGTCTGCAGGAGGTGGGGAAGGCCGAAGCGGAGCGTCCCGCCAGGTTTCTCAGCAGCCTGTGGGAGCGCTTGCCTCAGAACAACTTCCTGAAGGTGATAGCGGTGGCGCTGTTGCAGCCGCCTTTGTCTCGTCGGCCCCAAGAAGAGTTGGAACCCGGCATCCACAAATCACCTGGAGAGGGGAGCCAAGTGCTAGTCCACTGGCTTCTGGGGAATTCGGAAGTCTTTGCTGCCTTTTGTCGCGCCCTCCCAGCCGGGCTTTTGACTTTAGTGACTAGCCGCCACCCAGCGCTGTCTCCTGTCTATCTGGGTCTGCTAACAGACTGGGGTCAACGTTTGCACTATGACCTTCAGAAAGGCATTTGGGTTGGAACTGAGTCC

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Vous ne trouvez pas le bon produit ?  

Essayez notre Outil de sélection de produits.

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Jiankun Yu et al.
Journal of breast cancer, 16(3), 291-299 (2013-10-25)
Fanconi anemia complementation group F (FANCF) is a key factor to maintaining the function of Fanconi anaemia/BRCA (FA/BRCA) pathway, a DNA-damage response pathway. However, the functional role of FANCF in breast cancer has not been elucidated. In the present study
Jiankun Yu et al.
International journal of nanomedicine, 11, 6651-6666 (2016-12-21)
Two different disulfide (SS)-containing poly(amidoamine) (PAA) polymers were constructed using guanidino (Gua)-containing monomers (ie, arginine [Arg] and agmatine [Agm]) and N,N'-cystamine bisacrylamide (CBA) by Michael-addition polymerization. In order to characterize these two Gua-SS-PAA polymers and investigate their potentials as short
Yanlin Li et al.
PloS one, 7(8), e44254-e44254 (2012-09-07)
Fanconi anemia complementation group-F (FANCF) is a key factor to maintain the function of FA/BRCA, a DNA-damage response pathway. However, the functional role of FANCF in breast cancer has not been elucidated. In this study, we examined the effects and
Miao He et al.
Oncology reports, 29(5), 1721-1729 (2013-02-27)
In the present study, we downregulated FANCF expression by small interfering RNA (siRNA) in OVCAR ovarian cancer cells to address the effects of decreased FANCF expression on the function of the Fanconi anemia (FA)/breast cancer susceptibility gene (BRCA) pathway. Furthermore
Lin Zhao et al.
International journal of oncology, 45(1), 129-138 (2014-05-03)
The Fanconi anemia/BRCA (FA/BRCA) DNA damage repair pathway plays a pivotal role in the cellular response to DNA alkylating agents and greatly influences drug response in cancer treatment. However, the molecular mechanisms underlying the FA/BRCA pathway reversed resistance have received

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique