Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

Autres documents

EHU002271

Sigma-Aldrich

MISSION® esiRNA

targeting human LEF1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CCAGATGGAGGCCTCTACAACAAGGGACCCTCCTACTCGAGTTATTCCGGGTACATAATGATGCCAAATATGAATAACGACCCATACATGTCAAATGGATCTCTTTCTCCACCCATCCCGAGAACATCAAATAAAGTGCCCGTGGTGCAGCCATCCCATGCGGTCCATCCTCTCACCCCCCTCATCACTTACAGTGACGAGCACTTTTCTCCAGGATCACACCCGTCACACATCCCATCAGATGTCAACTCCAAACAAGGCATGTCCAGACATCCTCCAGCTCCTGATATCCCTACTTTTTATCCCTTGTCTCCGGGTGGTGTTGGACAGATCACCCCACCTCTTGGCTGGCAAGGTCAGCCTGTATATCCCATCACGGGTGGATTCAGGCAACCCTACCCATCCTCACTGTCAGTCGACACTTCCATGTCCAGGTTTTCCCATCATATGATTCCCGGTCCTCCTGGTCCCCACACAACTGGCATCCCTCATCCAGCTATTGTAACACCTCAGGTCAAACAGGAACATCCCCACACTGACAGTGACCTAATGCACGTGAAGCCTCA

Numéro d'accès Ensembl | humain

ENSG00000138795

Numéro d'accès NCBI

NM_016269

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... LEF1(51176) , LEF1(51176)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

12 - Non Combustible Liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Rhys G Morgan et al.
Haematologica, 104(7), 1365-1377 (2019-01-12)
Canonical Wnt/β-catenin signaling is frequently dysregulated in myeloid leukemias and is implicated in leukemogenesis. Nuclear-localized β-catenin is indicative of active Wnt signaling and is frequently observed in acute myeloid leukemia (AML) patients; however, some patients exhibit little or no nuclear
Yaoyao Chen et al.
Stem cell reports, 1(3), 209-217 (2013-12-10)
Germline-competent embryonic stem cells (ESCs) have been derived from mice and rats using culture conditions that include an inhibitor of glycogen synthase kinase 3 (GSK3). However, rat ESCs remain susceptible to sporadic differentiation. Here, we show that unsolicited differentiation is
Julia Dräger et al.
Oncotarget, 8(2), 3259-3273 (2016-12-15)
Rhabdomyosarcoma (RMS) is the most common soft tissue sarcoma in children and show characteristics of skeletal muscle differentiation. The two major RMS subtypes in children are alveolar (ARMS) and embryonal RMS (ERMS). We demonstrate that approximately 50% of ARMS and
P Wu et al.
Cell death & disease, 5, e1085-e1085 (2014-03-01)
Inhibitor-of-apoptosis protein (IAP) inhibitors have been reported to synergistically reduce cell viability in combination with a variety of chemotherapeutic drugs via targeted cellular IAP (cIAP) depletion. Here, we found that cIAP silencing sensitised colorectal cancer (CRC) cells to selenite-induced apoptosis.
Xinyu Wang et al.
Journal of Cancer, 11(10), 3072-3081 (2020-04-01)
Background: Our previous studies reported that lymphoid enhancer-binding factor 1 (LEF1) was upregulated in esophageal squamous cell carcinoma (ESCC) and the positive expression of LEF1 was correlated with aberrant clinicopathological characteristics in ESCC patients. However, the upstream mechanism of regulating
Afficher tous les articles scientifiques apparentés

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique