Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

Voir toute la documentation

EHU000271

Sigma-Aldrich

MISSION® esiRNA

targeting human F2R

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

100

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CGGGCTCAACATCACTACCTGTCATGATGTGCTCAATGAAACCCTGCTCGAAGGCTACTATGCCTACTACTTCTCAGCCTTCTCTGCTGTCTTCTTTTTTGTGCCGCTGATCATTTCCACGGTCTGTTATGTGTCTATCATTCGATGTCTTAGCTCTTCCGCAGTTGCCAACCGCAGCAAGAAGTCCCGGGCTTTGTTCCTGTCAGCTGCTGTTTTCTGCATCTTCATCATTTGCTTCGGACCCACAAACGTCCTCCTGATTGCGCATTACTCATTCCTTTCTCACACTTCCACCACAGAGGCTGCCTACTTTGCCTACCTCCTCTGTGTCTGTGTCAGCAGCATAAGCTGCTGCATCGACCCCCTAATTTACTATTACGCTTCCTCTGAGTGCCAGAGGTACGTCTACAGTATCTTATGCTGCAAAGAAAGTTCCGATCCCA

Numéro d'accès Ensembl | humain

ENSG00000181104

Numéro d'accès NCBI

NM_001992

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... F2R(2149) , F2R(2149)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Vous ne trouvez pas le bon produit ?  

Essayez notre Outil de sélection de produits.

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Omozuanvbo Aisiku et al.
Blood, 125(12), 1976-1985 (2015-01-15)
Protease-activated receptor-1 (PAR1) couples the coagulation cascade to platelet activation during myocardial infarction and to endothelial inflammation during sepsis. This receptor demonstrates marked signaling bias. Its activation by thrombin stimulates prothrombotic and proinflammatory signaling, whereas its activation by activated protein
Zhuang-Zhuang Tang et al.
Phytomedicine : international journal of phytotherapy and phytopharmacology, 78, 153314-153314 (2020-09-04)
Sarsasapogenin (Sar) shows good effects on diabetic nephropathy (DN) through inhibition of the NLRP3 inflammasome, yet the potential mechanism is not well known. This study was designed to explore the regulation of thrombin and/or its receptor protease-activated receptor 1 (PAR-1)
Clément d'Audigier et al.
Angiogenesis, 18(3), 347-359 (2015-06-01)
Endothelial colony forming cells (ECFC) represent a subpopulation of endothelial progenitor cells involved in endothelial repair. The activation of procoagulant mechanisms associated with the vascular wall's inflammatory responses to injury plays a crucial role in the induction and progression of

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique