Skip to Content
Merck
All Photos(1)

Key Documents

EHU137391

Sigma-Aldrich

MISSION® esiRNA

targeting human RECQL4

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TACGGCTCAACATGAAGCAGAAACACTACGTGCGGGGCCGGGCACTCCGTAGCAGGCTCCTCCGCAAGCAGGCATGGAAGCAGAAGTGGCGGAAGAAAGGGGAGTGTTTTGGGGGTGGTGGTGCCACAGTCACAACCAAGGAGTCTTGTTTCCTGAACGAGCAGTTCGATCACTGGGCAGCCCAGTGTCCCCGGCCAGCAAGTGAGGAAGACACAGATGCTGTTGGGCCTGAGCCACTGGTTCCTTCACCACAACCTGTACCTGAGGTGCCCAGCCTGGACCCCACCGTGCTGCCACTCTACTCCCTGGGGCCCTCAGGGCAGTTGGCAGAGACGCCGGCTGAGGTGTTCCAGGCCCTGGAGCAGCTGGGGCACCAAGCCTTTCGCCCTGGGCAGGAGCGTGCAGTCATGCGGATCCTGTCTGGCATCTCCAC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Chen Qiao et al.
Oncotarget, 7(13), 17009-17020 (2016-03-10)
Oroxylin A is a flavonoid extracted from the root of Scutellaria baicalensis Georgi. We previously demonstrated that oroxylin A induced apoptosis in human colon cancer cells via the mitochondrial pathway. In the present study, we investigated the underlying mechanisms responsible
Alvin J M Ng et al.
PLoS genetics, 11(4), e1005160-e1005160 (2015-04-11)
RECQL4 mutations are associated with Rothmund Thomson Syndrome (RTS), RAPADILINO Syndrome and Baller-Gerold Syndrome. These patients display a range of benign skeletal abnormalities such as low bone mass. In addition, RTS patients have a highly increased incidence of osteosarcoma (OS).
Ying Wai Chan et al.
Nature cell biology, 20(1), 92-103 (2017-12-20)
The resolution of joint molecules that link recombining sister chromatids is essential for chromosome segregation. Here, we determine the fate of unresolved recombination intermediates arising in cells lacking two nucleases required for resolution (GEN1 -/- knockout cells depleted of MUS81).

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service