Skip to Content
Merck
All Photos(1)

Key Documents

EHU111231

Sigma-Aldrich

MISSION® esiRNA

targeting human ACTA2

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ACCCACAATGTCCCCATCTATGAGGGCTATGCCTTGCCCCATGCCATCATGCGTCTGGATCTGGCTGGCCGAGATCTCACTGACTACCTCATGAAGATCCTGACTGAGCGTGGCTATTCCTTCGTTACTACTGCTGAGCGTGAGATTGTCCGGGACATCAAGGAGAAACTGTGTTATGTAGCTCTGGACTTTGAAAATGAGATGGCCACTGCCGCATCCTCATCCTCCCTTGAGAAGAGTTACGAGTTGCCTGATGGGCAAGTGATCACCATCGGAAATGAACGTTTCCGCTGCCCAGAGACCCTGTTCCAGCCATCCTTCATCGGGATGGAGTCTGCTGGCATCCATGAAACCACCTACAACAGCATCATGAAGTGTGATATTGACATCAGGAAGGACCTCTATGCTAACAATGTCCTATCAGGGGGCACCACTATGTACCCTGGCATTGCC

Ensembl | human accession no.

ENSG00000107796

NCBI accession no.

NM_001613

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... ACTA2(59) , ACTA2(59)

Related Categories

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Ling Li et al.
BMC microbiology, 8, 26-26 (2008-02-08)
Porphyromonas gingivalis is associated with periodontal disease and invades different cell types including epithelial, endothelial and smooth muscle cells. In addition to P. gingivalis DNA, we have previously identified live invasive bacteria in atheromatous tissue. However, the mechanism of persistence
Melissa A Kinney et al.
Scientific reports, 4, 4290-4290 (2014-03-07)
Stem cell fate and function are dynamically modulated by the interdependent relationships between biochemical and biophysical signals constituting the local 3D microenvironment. While approaches to recapitulate the stem cell niche have been explored for directing stem cell differentiation, a quantitative
Charlotte Thålin et al.
Thrombosis research, 139, 56-64 (2016-02-27)
Large elevations of high sensitive Troponin T (hsTnT) in ischemic stroke patients is associated with a poor outcome. In a pilot study we found a high prevalence of malignancies among these patients. Since neutrophil extracellular traps (NETs) have been linked
Xiao-Yang Wang et al.
Molecular cancer, 9, 221-221 (2010-08-24)
Musashi1 (Msi1) is a conserved RNA-binding protein that regulates the Notch and Wnt pathways, and serves as a stem cell marker in the breast and other tissues. It is unknown how Msi1 relates to other breast cancer markers, whether it
Omar Khalid et al.
PloS one, 11(3), e0150850-e0150850 (2016-03-18)
Cardiovascular disease, a progressive manifestation of α-L-iduronidase deficiency or mucopolysaccharidosis type I, continues in patients both untreated and treated with hematopoietic stem cell transplantation or intravenous enzyme replacement. Few studies have examined the effects of α-L-iduronidase deficiency and subsequent glycosaminoglycan
View All Related Papers

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service